Description :
From Genome Similarity Track
Location :
Scaffold_175:19055- 21595
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_175-snap-gene-0.12LMBR1 domain-containing protein 2 homolog A
Pytiw_DAOMBR242034maker-piw_contig_175-fgenesh-gene-0.6Protein kinase

Sequence
2540 bases(100 bases per row)
CGCACTTGGCATGGGCGTGGCCTCATTCTGCATTCTCTGGGGCGAGCTCACCTTGGGCATCTCGGGCTCGTCCTCCGTGTCACTCTTTCGCGCCTTTCCC
CACCAGTGGGGACCCAACGCCTCGGAGCTCGTGGCGTTTCTCACGCTGCTCTATATGGTCGTGTGCGCGTACTCGAATCTCTTCAAGCTGCGCGCGTTCG
GACGCTTNNNNNNNNNNATGTCGATTTGCTGCGCACTTAGCATGGGCGTGGCCTCACTCTGCATTCTCTGGGGCGAGCTCACCATGGGCATCTCGGGCTC
GTCCTCCGTGTCGCTCTTTCACGCCTTTTCCCACCAGTGGGGGCCCAACGCCTCGGAGCTCGTGGTGTTCCTCACGCTGCTCTACATGGTCGTGTGCGCG
TACTCGAGTCTCTTCAAGCTGCGCGCGTTCGGACGCTTTGCGCTGCGCCAGCATCACAACTCGACCGACCTGAGTCTGCTCAGGACGTCGGTCTACCAGT
GCCGCCTGCAGTTCGCCGTCGGATACAATTTCCTGCTGCTGCTCCACGACCGGAGCCTCACGGACCGCACGGCGCTTGCGAGGCTCTTTGAGAACATGGA
GGTCGTGCACGTGCTAGGCCGCGACTTCTCGGTCTATGCGCCGCTGCTCATGGTGCTGCTGGTCGTGTTCACTCTCTCGAACGGGTACGCGCACGTGATG
AGGCGACTGGGCGTGGACCAGTACGAGCAGGTGGTGCTCGGGAATCCGGATCATGCCGCGCAGATCCTCAAGGGCGAGGCGCTCGTGCAGCAGGGACTAG
AGAGGTACAGAACCGTCATTCGCAGGCAGAAAGGCGCCGCAGTGGGAGACAGCTACGGGTTTGCCCATACAACGTCGAGCGCACAGGCGCTGCTCGATGA
CGACGAAGATGACGATGGGGGTGGTGGTTTCGAGAGCAGCAGCGTCAGCAGAGGAGCGACCACCACACACTCGCGGGCGGTGGAGATACCCTAACTCACA
GTAGCAATTCCAACTGGCAGACTAAAGAATCCCGACGACCACAACGCAGCATCACGAGGACATCTATGGCGAAGAAATATGTTGGCTAGTTCTCTTCATC
TGACCTCCACACGGCCTCTTGTATTCCAAAAGATGTTGATTGGTAGACATGATGTTGCAATCTTGTATACCGTTGCGTTCAATTGCTGCGACGACGAGCC
CAACTCTCTGGTTCGTATTCTGTTGGACTTGGTGACTCGACCAGGCGGAGCTGGAGCTCAACATTCATTTCAATCACGCGTGCTTGATATCATCTTGACC
AGTCAGTCAATGAAGTGACGGACGCCGCTGCAGCTTCCACATTGACGCAAACATCTCGGAGGTTGCTACGGAGGATGAAGCGACGCTTTCTGTTCTTCCA
GGCGACGACTTTGCGACCCGGCCCGGTCTGCAGGGGCTTCCTTGATGAGATTGCGGCTGTGGGGGTGATTGGAGACAGGATACGCATGAACTCTGGTACC
CGAGCGCACTGGAGACGAGAGCATCGTTGGTGATACAGCTGAGGGGCTTCTCACGCAGGAACTTGGCGACGGTGGGCGTGGCGAAAAGCATCCGGTTACG
AACGAACCACCAAGAATCGAACTGGCTTGGCCACTGAATTCGACTGCAGGTAGAGCTCTGGATGACACTGGTGGGGTCTTGAGTGAGACACAATGTCGTT
GTTGTAGCTGGTGCTGGTGAGTGGAATGCTCGACTCGACTCGCTTGATTCCCTCGTGATGCCAAAGACCGTGTTGGTGATGAAGGCGTCTTGCTACTGGA
GTTGCCGTCTGGTAGGAAGATTGCGTAGGCGCTCGTCGTACTCTGCTTCTTGTCTCTCAGGTGGCGAGCGAGTTGCGTGCTCTGGCGCTCATCAAACTTG
CCGGTGACTGGGTTTGCGCGCGCGAGCACCTGCCAGGGCTTCTCGACGTGGAAGTACGACGGGTCCTTCTGCGTCTCGACCAGGTCGTGGTTCCAGCGAT
TGCGCTCGAGCAGCGAGTTGCGGATGATCTGGAGACTCTGTGGCGTTAGCCGCCGCCAGCCGCGCTCCGATAGCTCCAACACTTGCACTCGAGTGCAGCA
CATGTACACTGTTGCTGTCATCTCCGCTTGACTTGTCGCTGAGTGGTGAGGATGCTGCTGTTGAGGTGATGCTCCGAGCCCAGTTATCAAAGCTTGAGTT
CCTCCTTGAAGGCTTGCGACTGGCATGGCTCCACTGATGTTTGCAAACGCGACTGCCACTCCAAAGAACTCGTGCGGGCCGATCGTTGCGACTCGAGTCA
GCACCGTTTTCTGAGGCAGAGGCGCTCCGACTGCTGTACTTGCATGTGGCGGCGATGTGCTGAGCGCCGGGATCGCTGACGCGGGCACGGTTTTCTTGAC
AAAGACTGCGATCTCGCCGCTCTTGACGATGTAGAGCGTTCGCAGGTGCATCGGCTCCTTCAGGAACAAGTGATGGGACTCGTAGATGTTCTGCTGCATG
TCGTGCGCCACTCGAATGCACTGGCCAAAGTCGCAGCCTT