Description :
From Genome Similarity Track
Location :
Scaffold_448:19055- 20783
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_448-snap-gene-0.14Transmembrane protein

Sequence
1728 bases(100 bases per row)
AAACCATGCTCCCGGCACGGGCTCCAACAAGATCGACATCGCGACGGCGTCTCGCTTGTCGTATGTGAGCGGCGCCTCGCAAGCCAAGGACGTCGAAGAA
GGCTATTCGAGTGTCAAGACGCCTGATGCCGACGGACTCTATGAGGGAGGTGCGATCCGAGCCGGTGGAGCACCTGTGCTGACGAGCCGAGACAACATTG
GACTGCTCGTTCAGTACGCCGTCGTTGGTCTTGTCTACGGGATGCTTCCCGAGACCATCTACCCGTTCTTGCAGGAGTACCTCAACTGCAGCGGCGCTCA
AGTGACGACGGCCAGCACGTTGGTGGTACTGCCCTGGAGCTTCAAGGCCATCTACGGTATCATCTCGGACTGTTTCCCGATCTGCGGGTATCGCCGACGC
CCGTACATGCTCATCGGCTGGTCCATCTGCCTCATCATGCTGCTCGTCATGGCGTGCCTCCCGATCGGCAAGCCGTATTACACCGTGGCATCGGATCGCG
ATATCGACACGGCCGACTACACGCCAGAGATCGAGGCTCGCATCAACTACGACGCTCCGTCGGAAGGTGCCAAGTACGTCATGCTCATGTTCTTCGCGGC
GTTCGGGTATGTCATGTCGGACGTCTGTGCCGACGGCATCACGGCGGAGCTGGCACAGCGAGAGCCCGTCGAGGTGCGCGGCAAGACGCAGACCATGATC
TACACGGTGCGCACCTTCGTCGTGATCATCGGCGAGATCATTGTTGGCTTCTGCTTCAACGGCGAAGAGTACGGCGGTGACTTCGACTTCTCGCTCAGCT
TCCCGCAGCTCATGATCCTGTGCACCGTGTGCACCGTGCCAGTGCTGCCAGCGACGTGGTTCTTCATTAAGGAGGAGAAGCACGAGAAGCCCGACTTCAA
GCTCTACATCAGCGGTCTTTGGGACCAGCTGTGCAAGCGCGCGGTGTACCAGGTCATCGCCTTCACCTTCTTCTACAACCTCTTCTCGGACATTTCGTAT
ACCGCGAGCTCTCCCGTGCAGTCGTACATGGTTGGCGTCACGCCGATCAACAGCACACTGAGCGACATTCTGAGCAACCTACTCTTCATGTTCGGACTCA
TGGCCACGTCCAAGTGGGGACTGCGCTGGAACTGGCGCTGGATGATTATCTTCACCGGTGCGTTCGTGATCATCGTCGACTGTGCGACGACGCTCATCAC
GGTCTGGGACGTGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGCCTATTGCCGTGCAACTCCCGTACGGCGTCGGATGGATGATCACTTGC
TTCGTCATCGTCGAGCTCGTGGGTGAAGGAAACGAAGGTGCCATGTACGGCCTGGTCACGACCGTCTCGAACGTCGCATCGCCGTTCGCCACAACGCTGA
CGCTCGTGATCGACAACCCGTTCAACTTGACCAACGCGCGCATCCAGTCGGACGACCACTCGGTGCGACTCGACATCACCTACACGGTCATCATCATGTA
CGCCTTCACCGTTTTCGCGTGGGTGTTCCTCGCGCTGTTGCCGAGTCAGAAGGAGGCGTGCCAGGAGCTGCTGCGCACAGGTGGATCCAACAAATGGCTC
GGTGGTATCACGGTCTTCTACCTGACGTTCGCGCTCGTCTGGTCCGTCATGACCAACATCATGGCCATCTTCGACAGCACCTCCTGTCTCGTGATCGCGG
GTGGCTCGGGCTGTTAATCGAGCACAAG