Description :
From Genome Similarity Track
Location :
Scaffold_3:190503- 193306
Transcript NameFunction/comments
Phyci_207998hypothetical protein
Phyci_76143Hypothetical protein

Sequence
2803 bases(100 bases per row)
GATCCTCATCACTCCGGCCAAGACGCATGGGGATACATGGTCCCAAGTCTTCGGCGTGAACGAGTTCGGCCCCAAGGGGGCATTCTGGGGAAATATGCCT
GTATTTGCGCTGGTGTAGTGTGCGACGGATTCATCGACTTGATCGGCGGTTCTTCCGACAACATCAATGCCTCGCGCGTGCACGTGTACGTGACGCAGAC
CCCTGCAGGTAGTTCCGTCAAAAACATGGCTCATTACGCCGAAGGTATCCGCGATGAAACCTTTGCATTTACGACTACGCCTTCGAATCTTGCGAATCGG
CCTGTGCTCGACGTTAATTTTGTAAGAGCAAGGCCAAGTATGGCTGTTCGACCAGCCGGCATTCCCTAACGATACCCATGCACGGGTTTTATAACGGTGC
TCAGGACACACTGGCAACAACCAAAACTGATATCAACAAGGTGCGAGCTGGACTGCCTGACGGCATTATTGTTAAGACAAAAGTTTTGTCACAAACCTAT
CGATTTCGGCCACATCCACTTCACGTGGGCGTACAATGCTCACTAAAACGTCTACAACGACCTCATTCAGCTGTATGAAGGTAATAGTTACTGAGCGAGA
CAGCCTCATGGAGCTTTACATCGAAGTATGCCAAACCAAGTTGAAATGTCAATCATTGCTGCTGTTTATTATCGTTCTTTTCAAATCAAGCTGAGCTGCC
ACGACCGGTGCTGTCGTTAGGTTCACTACACGCGATTGTAGGGTGGTAGGGTGTCAAGAGAGCCAAAACTGCAGCTACCGGGTGTGTAGCTTCCAGTTCG
AGTCGCCATTTGAGCAATCGCGCAGCACGGGCAGCAACAAGCTTCACAGTAGTCTCCGCAGCAATTTCCCGGGATTTGGAACCTCTGTCGTGTAACGGAG
CGCAAGTGACAGATCCAGAATGGTAAGCAGGCCGACAAGAGGCAGGTGAAGAGGAAGCTCAGGAACAGCCCGCAACAGTAGGAGCTAACGCCCAGGCGCT
TGGAAATTTGTGCCAGAGAGATGCAGGGACAAAACGTCACCATGCAGCAGTTCGGGATCAAGTCGGTGCAGCAACCGCAGAGGCCGACCAACCAACTTCC
AATCATGGGCGGTGTGGCATCTGAAAATGGCACGACGCTGGCATATTGCTGGGCACCACTTCCACCGTACGCTTGTCCGGATGCTTGCCCTCCAGGATAC
TGCTGGCCAGGCAGCCAACCGCCCTCCAGGTCGGTAGGGATAGCTCCCGGTGGCACATCTGCTACGTGGCTTGGTTTCATGTTGGTAGAATGGCCTGGTG
GAGTCGAGCGCAGCAAAGCGAGTTGATGAATGCAGCCCTTGCTGACTCGGTGCTATGTTTTTCGGCTAGACATGCCCACACAACTATTTTTACAGCATGT
ATGCGAAGAAGTGCATCGAGCTCGTGCATTTCCACCACAATTCATATAGGGCAGTCGATGTTCACAGATGGCCGACAAAAATAAAGACCAAGTGCAAGCA
GAAAACTATTCGACAATGCCATTCTCCGACAACGGCTATCAGCCCCGGCAGATGGGAACCTGAAGTAAGGTGTACAGGCGAATTGTGGCGTTCTATGCCT
AATGCATTGCATTATGAAATCCAGAGCGTTTTAGCGATACCCGCACCGCCTAGGTTACTTCCGCGCCAACGTTACGGCGGGCACTCGACATCTATTTAAT
CTAATTGACGAAAGGAAAATGAGGTCCTGGACTCAACAGCACTATCGGCGTCCACTCCGATGCTACCCGATGCGTTGCTCAAGCTCGATGCGCCAGCACT
GTCCGTGTATCCAACTCCCTCAAATTTCTTAAGCTGCTTAAGCAGGTCCTGGTACATTTTCTCGTTCGCGTTGTATGCCCACGTCAAGTCGAGGTGACTG
TATTCCTTGACAGCAAGCTCATGAACGATCGTGCCGGAAGGAAGCGCACCGCGTAGCTGATCGATGTCTGTCGCTGTTGCGATTGTGTCGGCAGATCCAA
TGAAGAAACCTGTTCGTGGATACACCATCTTGCCGATTGGGAAGGCAGGCGGGTCGAAGCTGCCGTACACCTTTTTGTTTTTGCATTTGGACTCCTTGCA
CTCGTCGATATCAGAACCCCGATCACACTTGCAACCGTAGTCATACGACGCGAATGTGTTATCACGTATGCTCTGCGCATAGTGAGCCATATTTTTCACC
GAGGTACCCGCCGGTGTTTGTGAAATGTATACAGGAATCCGCGACGTGTTGGTACTCACGGACGGACCAGCGACGATAGAAATTGTGGTACTGCATAATT
TCTTCGCTAGCGTGCAGGCGTATCCACCGATAATTTCCTGAATGAACGTGCTCTTTCCAGAGAATTTTGCAATGCCGAACGCTTGAAACCATTTCTCCAG
GTGCATCTTCGCCATTGTTTTGAAGACGCCTGCAGTCAAGTGACCAGTCCAGGCCACAGGGGCAAGTGCTGCGAAATAAGACACCTTTTGGGCAAGTTCT
TGGTCAGTGGAGAACCCCACAAACGCCTGGGTGGTTCCTTCAGAATGACCAACGTAGCTCAGCATGGCGCTCTTGGTCTTGTTGAGGACGTAATTAATTT
CTGCTGGGAGGTCGTACTTGCCCATGTCTTCCCACGTGAACTCCCAGAACTCATCGTCGTCGTCCGTGTAGGTCAAATGTTCCCTCGACCATGTTGTGCC
ACGGTTGTTTGCGAGCCAAACGTCGTAGCCTGCGTCAGCGAGAAGGAAAGCCAAGCTCTGGTTGCGGAAGTTGCACACGAAGGTGAAGCTGCTGTCAAGG
AGA