Description :
From Genome Similarity Track
Location :
contig_31:19050- 20198
Transcript NameFunction/comments
g7095.t1hypothetical protein

Sequence
1148 bases(100 bases per row)
TTGCTAGAAGCCACTGCGGGCGTTGGAAACATTGAGATGGCTTCATGGTTGGTTGATATCGTCGGAGCTGACTGCTTGCGTCTGTCGGTAGCTAGTGCTG
CCCAGAATGCAATTTCAGGAGGCCATCTTAGCATGGTCGAGAGCCTGGTTGATATCACATCATCGATTAGTGGGCCGTTCTGTCTGGATGGAGCAGCTGG
AAAGGGTCATCTCCAAGCAGTGCAATGGGGGCTTCAACACGGTGGTGCATGCACCACTCAGGCTATGAACTCCGCCGCGAGAAACGGTCATCTGGAGGTT
GTGAAATGGCTGCACCGTTATCGTACAGATGGATGCACGACTCAAGCTATAGACGACGCCGCGGGTCACGGTCATTTAGGAGTCGTTCAGTGGTTGCATG
CGCATCGTTGCGAGGGCGGTACAACAAAGGCGATGGATGCAGCAGCGAGTCACGGGCATCTCGATGTTGTCACGTGGCTTCACCGCTATCGGAGAGAGGG
TTGCACAACCACCGCCATGAACGGGGCTGCTCGAGAAAATCATCTTGATGTAGTTCGATGGCTGCACACTCATCGCACCGAGGGCTGTACTCAGGAAGCG
ATGGACGGGGCTGCTTCTGGTGGAAATGTCGCGATGATGCAATGGCTCATTGTTCATCGCTCAGGGAATTGCAACTTTTCACGCTGTGCTTTGGATAATG
CAGCTGCAGGTGGCCACCTTGAAGCGGTGCGGTGGCTTTTCAAACAGCACTCACTTAGCGGTACCTCTGGGTGGATTGCATGCGATGCAATGGATCGCGC
CGCGAGCGGCGGGCACTTAAACGTGGTGAAGTGGTTTCACGAGCGTCGTCCTGAGGTCGGAAGCTGTTCCACGGCTGCGATGGATGGTGCAGCATCGAAC
GGCCACTTGGACATGGTGAAGTGGCTCCACTCAGAGCGTCGTGAGGGTGCTACATACCGGGCAATGGATGGTGCAGCAGCTGGAGGACACTTGGAAGTAA
TGATCTTTTTGTACATGAACCGCTCTGACGGGTGTACATCGGACGCAGCAGTGAAAGCTGCTCTGAATGAGCACGTGGAGGTCGTGCAATGGCTGCTTCA
ACGCTATCCTCAGCAGATCTGTCATGAACGGGTTCGCAAATTCGCCGC