Description :
From Genome Similarity Track
Location :
Scaffold_1868:1905- 2924
Transcript NameFunction/comments
Phyag_g11644hypothetical protein PHYSODRAFT_313849

Sequence
1019 bases(100 bases per row)
agtTCGAAACCACTTCACCAAGTTCCAGAAGAAACATTTTTCCGATTGTTCAGCCAATGCTTTCGTGTTTGATACAAACAGTTAGTGGTGGAGTGAAGAG
GATACTGCAAAAGCTCATGGAATTTAAGTGATGTTGGTCTACTTACGTAAGTATACGGTACGTGGAgatcactgctgctggataaAGCTGTCGTCAGTTT
GTTGTACGGGGCTCTCTGTGGTCTGTTGTGTCGAACTTCCACTAGCCTCTTGCGATGCGCTACTCTTATCCAGTTGGGAAAAGTTAAGTTGTGTCTGCTG
TGACGAATCGGTCTGTGTCTGCGGAGTAGGAGCGGTCGTAGTTTGCGGTTCTTGAGCAGATCCGTTGGCAAACATGTAAACGGACGAGAGCACCGTAGCG
TCTGCCTTAGAATTGTCCCAATTGACGCTGAAGAGTAAAGCCGACTCGCACGAGCTACCAAGCCCCGTCACCTTCAGATAGCCAGGTTCCCAGTAGAAAA
CACCGGCGCCCAAATTACTAGGCAGACCTTCCAGCACATCCATGATAGCAGCGACCCACTCGCTTTGGCCCTTTGCGCTCACCGGGTAGTCGGCACTCAG
TTCGACTTTCGTGCACTCCGTCGGCCAGTCGGTCTCTGCGATGTAGATCGGTTTGCTGTATGTGGACGCCAGTTGAGTCAGTGAAGACGTGAGTGCGTCG
ATGGTGGCCTCCGTGTTGTAGTACGGGTAGAACGAGAAACCAAACGCATCAACATCGTCCGTCGTCACTGTTCCTTCAGCGAAGAGGCTCTCAAAAAACC
ACGACATGGTCTCGTACTTCCATCCGTTGTCCAGGTGGATCATCACCTTCGGTTGAGTCGTACCGGCCGACACGGCGTCGGTCACACCTTGACGCGCAGC
TTTCCACAGCGTAGCGAAGCCACTGAAGTCGTTATCGCTGATCTTTCCGGTCGGGAAGAGAAACCCTTTGGTGACTTCGTTGCCCAGCGACAAGATGTCG
AGGTCCACACCGCCGTCCG