Description :
From Genome Similarity Track
Location :
contig_31:19045- 20193
Sequence
1148 bases(100 bases per row)
TTGCTAGAAGCCACTGCGGGCGTTGGAAACATTGAGATGGCTTCATGGTTGGTTGATATCGTCGGAGCTGACTGCTTGCGTCTGTCGGTAGCTAGTGCTG
CCCAGAATGCAATTTCAGGAGGCCATCTTAGCATGGTCGAGAGCCTGGTTGATATCACATCATCGATTAGTGGGCCGTTCTGTCTGGATGGAGCAGCTGG
AAAGGGTCATCTCCAAGCAGTGCAATGGGGGCTTCAACACGGTGGTGCATGCACCACTCAGGCTATGAACTCCGCCGCGAGAAACGGTCATCTGGAGGTT
GTGAAATGGCTGCACCGTTATCGTACAGATGGATGCACGACTCAAGCTATAGACGACGCCGCGGGTCACGGTCATTTAGGAGTCGTTCAGTGGTTGCATG
CGCATCGTTGCGAGGGCGGTACAACAAAGGCGATGGATGCAGCAGCGAGTCACGGGCATCTCGATGTTGTCACGTGGCTTCACCGCTATCGGAGAGAGGG
TTGCACAACCACCGCCATGAACGGGGCTGCTCGAGAAAATCATCTTGATGTAGTTCGATGGCTGCACACTCATCGCACCGAGGGCTGTACTCAGGAAGCG
ATGGACGGGGCTGCTTCTGGTGGAAATGTCGCGATGATGCAATGGCTCATTGTTCATCGCTCAGGGAATTGCAACTTTTCACGCTGTGCTTTGGATAATG
CAGCTGCAGGTGGCCACCTTGAAGCGGTGCGGTGGCTTTTCAAACAGCACTCACTTAGCGGTACCTCTGGGTGGATTGCATGCGATGCAATGGATCGCGC
CGCGAGCGGCGGGCACTTAAACGTGGTGAAGTGGTTTCACGAGCGTCGTCCTGAGGTCGGAAGCTGTTCCACGGCTGCGATGGATGGTGCAGCATCGAAC
GGCCACTTGGACATGGTGAAGTGGCTCCACTCAGAGCGTCGTGAGGGTGCTACATACCGGGCAATGGATGGTGCAGCAGCTGGAGGACACTTGGAAGTAA
TGATCTTTTTGTACATGAACCGCTCTGACGGGTGTACATCGGACGCAGCAGTGAAAGCTGCTCTGAATGAGCACGTGGAGGTCGTGCAATGGCTGCTTCA
ACGCTATCCTCAGCAGATCTGTCATGAACGGGTTCGCAAATTCGCCGC