Description :
From Genome Similarity Track
Location :
Scaffold_69:19040- 21229
Transcript NameFunction/comments
Phyta_totarag2805Intraflagellar Transport Protein 20
Phyta_totarag2806ubiquitin-conjugating enzyme E2, putative
Phyta_totarag2807hypothetical protein PHYSODRAFT_481677

Sequence
2189 bases(100 bases per row)
GAATGCTTGACCTGTAGAATCTGTAGATAGATGAAAAGGGTAAAGAAGTGCCCGTTTGAATGATTCCAAGACACAGCAACTTCCGAGCAGGTTTCTTCCG
AAAGATGGACTCCTTCGCATAAAGGCTGTGCTGCAAAGCCACAACTGGCTTCGACGTGTTGTAGCTCTTCTCTCGAGGCTGCATTAGCACTGCTTTGCAA
GGATAAACTGCATCAACTACAACGCCACGCTAAGTTACGCCTCAttgttgctgagcttgtccatgagcagttgctgctcgtcggCTATCTTCGTGAGCGA
CTGGTATTGCAGGTTGTATCTATTGCATGGCGCGCGGTAGGAGTGCGCAGCAAGGAATCAAGTGTTAGCAAACGCAGACGACAGTCTTCCATCTCGGCTT
TGAACGTACCGTTCCAATtcggtcttcttctccttgatcaGAAGCTCCAGCATATGCTTCTGGCGGTTCCGATTCTCCACTTCACTGTCTACTCGGTTGC
GTTGGCCGATCGCCTGTAAATTGTCACAAAGCACTCACATATCCATCAGCTTTCCGCCAACATTGATGATTCATCTTTTTGCTTGTCCAGCCCCTaacct
tcagcttctcgcgctcgatGCGCTTGGCCTGGCCCTCCATCACCTCTAGCACACCTTTCACGATATCATGGAACTCCTCTAGCTCTGTGATGGACAACAG
ATGCAGTCCACGTCAAAACTTGCCGCCATCTCCACAGAATTATTATGTACACTGCTGAAATCACGTGCTTGTCGCGAACTGGTTGCTCtcctgctcgagc
tcctgcGTGTGTGCGATATCCTCTTTGTCCAGTACGCGCACCTgacagtcgtcgtcgaagcagATGCTCGGAAGCTGGTTGTCTCCGCGGCTCATTCTCG
TTCGGTCAATGGTAGATagagatggctacatccaTGTAGATCGCGACGCTTCAtcacggtacatgtactaccaGGTTATTACTACCAGGAAGACATAATG
TTAGTCTTGAAGGATGAGCAAGGCAAATAAAAAGATGAATACGAACGTGAAGCGCCTCCGCAAGGAGCTAcaagagctcaagaagaacccGGAGGAAGAC
ATGGTGCTGTACCCGGAGGAGGACACCATCATGCGCTGGAAGGCCTTCATCCGCGGCCCCAAGGACACCCCGTTCGAGGACCGCTGCTTCGAGTTGGCCA
TCCAGACTACGCCGCTCTACCCCATGGAGCCGCCCAAGATGAAGTTCATCACCAAAATCTTCCACCCTAACGTGCATTTCAAGGTGAGACGGCACTGCAC
CTGCTAGTGATAATGTGGAGTAAAAGGTGTCATAGGGGGTTGGTTGGTTATAACTGCTGACGGGATTTTGTGTTATTGTACTATGTGTCACTCGCTGCAG
GATGGCAGCATCTGCCTCGATATTCTCAAGCGCGAGTGGTCACCAGCGTGGACCTTGAGGGTGAGCCGAGTCTGGTTTGATGCTGTAATTGTAATGGGGG
AAGATGTTGACTGTCGTTCATGTGCTTTTAAGGCTGCGTGTTTGGCTGTGATCTCGCTCTTGTCGGACCCCGCGGCTGACTCGCCCCTCAACTGCGACGC
CGGTGAGTGCGCGACGGTAGACAGATGAATGAGCTGTGCTGACCAAGTTGGGGTGTTGCTTGTCACGCAGGAAACATGATTCGTGCGGGTGACATGTTGG
CGTACAACACTATGGCCGAGATGTACAAGAAGGAGTTCGgactgctggagctgccaaAGGTCCCGTTCTAAAGGTACACACGCGGCCTGTAAAGTAAAGT
TTGCATGAACCATTGGGTGTCGTAGGGTGGCAAAATTAATTGCTCAGACGTTTGTGCTACTTGCTTTATTCACGTGTCGGCTGTCTCCTCATTTGGTGAG
GGATTCTCCTCGACTTGGCTTTTCGGAGCAACCAAGTCGCCGTAGTAGGCCGTCACAACCTTTAGCTGCTTGTTTAGGAAAATCTTTTCACACTCGACGG
GCTCTCCAGGTGTTAGCGCCTCTAGGTCCTTGGTAGGTGTCCCCCTTGGGAGGTAATACGCGATATTCTTCGTCACTTTGCGAGCCATGGCAAACAGATC
CAACCCAGACACTCCTTTCACGAGCATATCTTCCAAGCTAAAATGCTTTCGGCTGTACTGTACTCCACCCCAGGGAGGCGATAAGAATA