Description :
From Genome Similarity Track
Location :
contig_105:19038- 23433
Transcript NameFunction/comments
g13053.t1hypothetical protein
g13054.t1hypothetical protein

Sequence
4395 bases(100 bases per row)
GATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAG
TCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGC
GAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTCGGTCCCTATATAT
TGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGG
GACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATAC
AGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGG
TGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTG
CATATAGGTTCTTACCTTAACGAGCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGTACCAGCAACGCCGGC
GAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCGTTCGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTT
GATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTAT
CTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGA
TGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAAC
CGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCG
GTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAGTACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTT
CCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAG
GCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCATTGCCATTGACCCCTGGGAGACGCCCCAGAGGGT
CGACCGAGGCCGGAATATTTTCGGCCCAAGGTGCGACGTCGACGTATTTCCAAGACTCTCACATGGTGACGCCAAGGTCGGTCAGTCGTACAGAACGACT
GGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGTGATGACTCATCTGAC
GAAGATTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGTTGAGCGTGGTGGAGAATGACAGTGCGACAC
CGAGGCTAGAGATCGCCACGCACCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTT
CATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTG
CCCCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGG
CCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGC
AAAGGACCACGTCGAGCACTTCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGAT
ATGATCAATGATATCCTTCGTCGCAGGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGG
ACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGTCGCCGG
GATGACCAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGGACGCGCGTGGAGGATAC
CCGGAAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACG
GATACGCGTCGACCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGTCG
GCCGAGGGCAAGTAACGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCC
TGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCA
CGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAA
ACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGACT
TGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGGAGT
GGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGG
TGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAG
CGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGG
GGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGTTATGGATCACAGTGCAGGAGTGA
CGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCCTGGTG
AAGTCGCAGAACCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATTTA
GGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTTGACGGGGACAGCC
GACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGG
GATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAAC
TCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTG