Description :
From Genome Similarity Track
Location :
Scaffold_441:19037- 25302
Transcript NameFunction/comments
Phypl_g8355hypothetical protein PHYSODRAFT_472758
Phypl_g8356hypothetical protein

Sequence
6265 bases(100 bases per row)
AATTCTCTCCCCGTTTGCTGCAAACCTCCAGTTTCGCTTGCACGAACGGAAGTCAAGCGCTAAAAAAGAGTTCTACGTTCAGGTTCTTGTCAATGAGAAG
GAAGTTCCAATTCCCGGGTGCGGACGCGTCTTCTGCAAATTGTCGGAGCTTGAGAACCTGTGGCACTACTACTTGAAGACGTACAACTTCCATGAGGATT
GCTTGTAAATTGTCAATGAAAAAACGAAATTTCCATTTAGATGTGACTAGCCGCGTGTACACGGACGGATCCGTGGTCGCCCCTTCAGCTCAATAGACCG
GCTGGATCGAATGCGTGGATGGCTTCTGTTGCGGCATCTGCAAGCTCCGCCACCTCTAGTTCAATTTCGCTGCCTCTTGACAtttctgctggagaagctg
gcgattGTCTAAGCACGGATGCTGCCAAGAAGCGACGAGAGGTTCTCAAGTACTTGTTTGTCAGTGGATGCATTTGAATTGAACATGTCGGTGGACTCAC
GTGGTAGATGTGTGTTGCTTAATACCGTGCAGGATGAAGTCAACCAAGTTCTCAAGTCTGAATCAGAGTCACCAGCATAGCGCTACAGACATGGCGATGC
CCATTCCTCTCGGAAGCGTGGTGGAGCTTAAGTTTGACTTCATTTGTGCAACTTCGCCCGCCGAGGCGGAATATCTGCGAGaatttgttgctgctgggaa
AGAAGGAAACCAGCAACTAGCAGTACACGGTCGGCTTCATCTCATCGGTGGAGCCTCTCAACGTTCAGTTGCAAGCGCTGTCATTAGCGCCGAAACCAAG
CACTGTGATAGCCATACATGCTTGCGACTGCAAACCGACAAAGGCAGCCCAGTTACGCTTCGATTCGAGCTCAGTCCTGACGTTGTGACGAATCCACTTC
CGCAACTTTCTCTCGAGATACGCTCAAGGCGATCACAGAAAAGAAAATTATCGCTCTCCATAGCGTGTGAATACTTGTTGAAAAAGCTAGCGATCGGAGT
GGAGTATCAGACCAACGCGCAACTTCTTGATGAACAAGATCGCCCTTGTGGTCGTCTGAACACAAGCTGTCGTGGTGGATTACAGCCCGACCTGGAGAAT
TGTGATCAAGCATGGACAACAGTGGTGCTCGAACCCGAAGCCTGTATCCTCACGGTAAGGGTATCCGATCTGCAGGCTTCACAAAATGAAGGTAAAGATG
CTCGTTGCTTCGCGAGAATCTGGTCAAGTACAACAGGAAAAACGCGTGGTCAAACTGTATCGCCGTTGGTGTGGAAAAACGGAGAAGCAGCTATCGAGAA
TGGGGAAGCGAAAACTGTGTCACTACAAGTGGCCGATGCAGCTTCGGAGATCATTTCTGTAGGCATCTATCGGTACAGCACTCACGAGAGGAATGAGTTG
ATTGGACTCGGCAGTTTTACCATTTACCCGTTGATCCTGCCACCAGGGGCTGAAAACCAGCCAGTCGAGCAGAGTATGCGTCTGTACTCGGAATCTGCGG
GTAAGGAAAATGAATGCGGATCAGCGATGCTTTCACTTCAAACAACTCCAGCGCTTCAACAAGATGATGCGGATAAACTCGTCTCGCTTGCCGCTACTGG
GCTTGGTAGCATCGCGTATCCCGTGCAAAGTGGAGAAATGAAGTGTCGAGTCGATGTCGACATTCTGGAAGTACAAGCTCTGCCCTCAAATCTTTCAGAA
GGTGATAGCGTTTCGATCAAACTCCGCATTGCGCAAAGCAACTGGAAAGCTGAGTTAGCTGCTGCAAAGGTTGTTCTGGCCGCAGATGGCAGCAAGAGGC
TCGTCCCTGCTAGCGAGAACGCCAACACAGTTATATGCTGGGCCGCTAAAGATCGATCCTTCCCTGTACTGGAAGTTTTTGTGTACGTACTACCCCAGCA
AAAACCGAATCGGGTAGGAATGGCGTCTAGAGCTTCTCTAGCAACCACTTCACACGCAAAACGCAGTCAAATTTCAATAGGAGCACAACGAACCAATGAA
GCGCTGACTCCAGCATTGATGGCAACTGGTAGTCTTAACCTCAGCTCTCTTTTTTTGCAGCAGAACGTATCGGTATTCATTGATTTACGATTGGATGTGG
AAAAAGCATTCGTGGACATTGATACTGAGCGTGAACGAGGACTTGAGAAAGTGTCGCTGCTCTCAAGATTACGAGCTTCATCTTCTCAAGCAAATGGTGC
CAAGTCGCCAGCCTCTCTTGGATTTGCAAACCGTGTATCCCAGCCTGTCAATGGAGATGTGTGTGTTCATCTGCTACAAGCAAGTGGCAACGTTTTCAGA
AAATTGAGCTCTCTGTCGAGTTACTACGTGGTGGTTTCCGTTGGACCACAGGAAGTAAGGAGCAGGTGCGTGCCGTGGTTCCATTGGGTCGATAAAAAGA
AATAGTGTGTACTAACTTTGCTGAATGTTtgagtacatgtagttgcTGCGCAATAGATGATGCCTATATGATATCATGGAACCAGCAGCTAGCGCTTTCA
CTTGCGTGCTCTGGACCACCGATCATCCACCTCACGCTTTATCAACGTACACTTGATTCGATCTTGCCATCCGAGTGCGACACCGCCAGTCAACGTCGTA
GTAACGACCAAGTCATTGGTTATTTGACCCTACCTTTGTTCCCGTCGGTACTTGAAGAAGACCATCTCGTACAACTCGAACTTCCCTTTGGGACACCAAT
GAACTTCGAGAGCGGTGAGGCGGCCAAGACGAGCAATGACCCGCACTACTACAAGCGAGGAATGCTATCACTGGAGCTGCAATTTCTACCTACAGAGCAA
CCCAAGACTGGCCCAACAATATCATCAGACGTTTTTGAATTGGTGATTCATCGAATGCGTGGTAACTTGCAGGACGCAAGTGGCTCACAACGTTCGCTTT
GTGTTGCAAAACACGTATACATTGATATAAGTATTGTAGATGATCGAGGTGGCTCAGCAGAGGAATTAGCCGTGGGGGCGACCGGCGTTATACCCCTCTC
ATCCTCGGGTCTAACGGAAGTCAGCGAGGTTGTCGACCTAAGCAACCCCATCGTTGCAGCTGCTCTATCGAATGGATCGAGTAATGTACTTGTCGGAAGA
ATCCGCGACTTGATCGGGAACAACTACGGGCGCGTTCATCTTCCACTGCGAAAAGACTGGAAGAAAAGACTCGTGCATCGGAAGAAGCAGGTTTGGTGCC
CTATCTGCCAGGAGTCACTCAACGCTGCTGTCACTGCGACAAAGGATGCAGTTCTTATGAGCTTGCAGATTCGTCAAAAAAGCGATCCAATCCCACAATC
CAACGCATTGGGAAAGTTTCATATCAATGTTTGCGAAGCTATCCTGGTAACGCGCTTTGAGAGTTCAAACTTGATGAAGCTAGGGAAATACGGCGGAGCC
AACGTACAGTTGAAGTACGCCTCGACGAAGGATTCTACCAACGCGATACGCTCTCGTACAAGACAATCTATCGCCCAAAACAACAGTCAGCACTGGCGTT
GGGAAAAGGAATGGGTGACATTTCCCCACGTGGGTGAGTCTCAAGAGTTGCAAGTTGGTTTTGAGATATCAAACCATTTGAGACTTGACGGCAAGTTCGA
TCTCTCTTCTGCGATagaagacgcagcacttCGACGTCTCGATGTATGGGTTCCACTATCGAATCAAGCTGTAAGCGATGGCCCTACGGTGAGTGCACAT
CTTCACGTTGTGATTGTGTATTTGCCGACGATTGCCGGTACACTAAGCATGGAGTTTGGAGAGAGCTACGCATTCTCCGAGTCCGAACGGATGCTTCACG
TGGAGAATATATTTTACAAATGCACTATTCACAACACGAGCTTCAGTTCTGCTGTTGTAGCAGAGGATACACTCGAGAGCACCACAACCGATGTATTGGC
TGGGAGTTGCTACACACAATTGCGCCTACCACTCGACACCAGACTCGACACAGCCGCTGGGATACCAGAATTTGTCATTCAACGGATGGGAGTGACCAAA
TCGTTAGGAGAATTTTGCTTGGGTGTGCTCTCGTTGGACTTCCTCTCGATGTCAAATCTCTGTTGCTTCGTGCCTTTCTCTGGAGAAACTCGAGAACGGT
TCACCTGGTGCGAATTTACTGACAAAAGCGACCGAACCAAGACAACGGGAGTCGCGAAGCTCCGTGTTGGGTTTGACCACACACTAATAACAGTAGCGGG
AACTCCAACCTCTGGAAGAGCGAAGATGCTCGAGACGCGAGTGGAACTGTTCACAATCTGGAAAAAGCTTTTCTACTTGTTGGACCAGAACGGCAACGGC
TTCATCGATCGCACAGAGTTcacgagcgtcttcgtcgatcACCTCGAAGGTACGTTTTTGTATATCATCGTCCTAAAAAACAAAACTATTTGGTTCGCTT
AAACGTAGCGTCTTGTTCATGTATGAAGTAGATATGACGGGGACGTCGGATGGTCAAAAGCTGTTGCAACTGCTGTTTGGAGACAATGACAATCAAGACA
ACAGCCTTGTTCCCACACCACAGCAGATAACGACAGTCTTCTCTGTCATGGATTCAAATCGAGACAATGTACGTCATAACCTAACACAAAGGTATCCTAC
CGTTTACCGCTCACAGCCAAAGCCAATTGTTCTTCTAGGAGATTGAATGGTCCGAGTATCttcgcttcctgcagcaaaagcagcaacagctctTCGCTAC
AGAGGAAGAAAATCCTGCTACTGACACTCGTGAGCCAGCATCTGAGCAGAAGCGAGAGCTATGCAGGAAGAACCGCGAAGATgggcgtccagctccgtcc
aGCTCTGGTAAACAGTCCATTATCGAGTCCACAGACCAGGGCGAAATGCCACAAGAAACAGTGAGAGAAGTCAAGGCGGTCTTGAAGCAGGAGCCAGCCG
CGCCGAAGCGACCTGGCAAGGCATCGTCCAGAGAGGAAAAGCTGCTGAGGCTTCAGTATTCAAATCAGGAGCAAAGccgcttgcagcagcaaataaACTC
ATTGGAAACGATCCTCGCCATAGAACGCCGACGATACGCGGAGCTCGCTGCCGACCGCCAAGCATTGATGCGCTCAtaccagcagctgcatctgAAGCAC
CAGAACGAGCTTATCCAGGAGCAAACCAAGGCAAAGTGGATGAAGCAGACaatcgagcgccagcagcaacaactcgagGAGCGAGAGACGCTCCGTCAGA
AGCGCGATCAAGCCTCGACAGTGCTACAATCCACACTTCGGTCACGGCTGGAGCACAAGCGCTACCAGGGCCTGAAACTCCAAcgcgccactgctgctaT
CTCCATCCAATGCTTGGTAAGACGTGTGAAGGCGGGGCAACAACTGCAAGTGCTTCAAGAACGGGATCGAGTGGCCAAACAACGATTTCGTGCAGCATCA
ACGATGCAGAGGTTTCTTCGGTTCCACGTGCATCGAAAGGAGCGAGCTCTGCTTCTGGAGGCACGGACACTCTCGGCGACAATCCTTCAGAAGAATGCAC
GCCGAATGCTAGCTGGCAATACGTGGCGGAGTCAAAAGGTGGCGGTCCTACAGCTTCAGCGCTGGGTCCGACAGTGTCTCGCGGCCAAGCGCTTGAATCG
GCTTCAGAATGCGACATCGGCAGTCAAAACGGCCGTGCTGGGATGGTTCGCGAGGCGGCAGTATATTCAACTGAAAGCAAGCTCGCACAAGCTCCAACGG
TGGTGGAAGCGAGCGAACAAAGAGCGAGCAGCgtacgtggagctgctggaagctgtgcTGTGTATCCAGTCAGCTTGGAAGCGGACGAGCGCCAGAAAAT
GGTACGAACGGGAGTGGCAACGACAAGAAAAATATTTATCCCAGCTGGAGGCCTCCACTTGTATTCAGGCGGCGTGGAGAggtcggcagcagcgtttgAT
GGGCATCAGAGGAACCCCACGGTTTGAAGATGACAGTGCAATCGAAGCGTTGCTGTACCAGTTGGTGGCTATGGTCGAGGCAGAAGTCGTGATCCCTGCT
GGCAAGGAACAAAGTGTTGCAACTAGAGCGACAGGAGCCCCGAGCGAGTCTTCGTCAATGGAGAGTTTAGTCGGTCATGACACAGTGGCAAGCAGTGCGA
CGGAAGAGGCGATTTTTTTTGAAGATGAACTCGTTGTTGGCGATGAAACAATCGGCGCTGTTGTGgccgtcttcttgaacgATCTGGTTGAAGCCGCGGT
CGGGCCCAATGAGGATGACGTCGGTATGACTCACGAGGGCGCCAGTGGGGATCAGAGCTACCCAG