Description :
From Genome Similarity Track
Location :
Scaffold_154:19035- 22310
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_154-abinit-gene-0.44Tetratricopeptide repeat protein 37 (TPR repeat protein 37)
Pytul_var.sporangiiferummaker-pug3_contig_154-snap-gene-0.26Conserved hypothetical protein

Sequence
3275 bases(100 bases per row)
CTTCGCGTTCTACTTGTCGCCAAGTGACTTTGACGCAACGGGAGACAGCGCGGAGTCGGCATCGTGGACAGAGTTCATTTCCAGCGGACGCAAAGCGTAC
GAAGCCGTTGCCGCGCTCTCCACAAAATCAAGTGAGACAGCGCCAAGTGCGGATCTTGCGCAAGTGCATTACGATGTCGGTGTGTGCAGCTGGTACGAGG
CGCAAGCGCTCTGCACCGTTCACGGGATCCACTTTTCTGGATTTGAGCACCTTAATTCCCCTCGTGCGCGCCAACTGGACGCCGAGATCGAAAAGCAAGC
TCCTGACGTTCTTGCGAGCGTCAAGAAGCTGAAGGACAAGGCGAGGGTATCTTTTCGAGATGCGCTTAAGGTGAATCTAGAGTATGGACTTGCCTGGAAC
GGACTTGGAGTCGTGCATGACCACATACTCGTCAAGCAGTTCGCATGGATCCGAGCTATTCAAATTGAAAGCAACGAGTCCGCGTGGGCGAACTTGGGTA
TGCTGTACGTTCATCACCCAGACGCAAAGCTTACGGCGTCGTTGGCACAGAAGGCCTTCATTCACCTGCAGGGTGTCAACGCGGACAACCCGTCGATGTG
GAACGGCTACGGCATGCTTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGAAAGCCGAGCAGCAAAAGTCGATTGAAGCGTTCCGGTGCGCCT
TGGAGGTAGGTTTGGATCTGGACGCGCTTCAAGGATTCACGACAGCGATCTTGCTCAACGAGACAGCTCGCAACGACGAGGAGCTCCTGTTTGCGATGCG
CAAGCTCTTGGAGCGAGATCCGTACAACAGTGGTGCTTGGAATGCGCTCGGAGTGCTGCAGCAACGACTAGGACTGCACGAAGCATCTCGTGGGTCGTTT
TCGAATGCGCTGTCGTATGTGACCAAAGCGCCTTGGTCTGTTCAACAAGGCCAGGAGGCGGGAGTGCAGTGGAATGCGAAGGTCGCTCTGCTTGGAGGCA
CTGACTCGGCTGGTAAAGACACATTTGGTCAAGCCATCGCCGCTGTTCAAGAGCTTTCATCTGGCCAAACGGTGCTACTGCGTGTGCTCAAAGCGCAGCA
ACTCTATTACGAATCGAACGGCAAGGGCTCTCTTCAAGAGCTGAACACTCTTCTCCAAGACAACCTTAGTACCTCGGAGAGAGACGTCGTTGCAGTCGTT
GGGCTCTCGATCGCCGGTCTGTTGGACTCCACACATCCGACGGAAGCAAAACTTGTGAGTTTATTGTGCAAAGAACACCTGCTGCGCAATGAGGAGGTCG
CCACAGAAGTCTCCAAGTTGAGTCTGCATGTGGTTGAAATGCACGCACGAGTCTTGGGAGTCGAGTCGGAGTGTCTCTCTTTTCTCGAGAACGCTGCGAA
ATCCAGCAACCAGAAGGTTTCCCCCTCGCTCTGGGCTCGTCTGGCATTTGCATCGATCGACTTCCAGAAGATCAACAATAACGAGCTTGTGTCTGCTTCG
CGCCATTCGGTGAAAAAAAATCGGCTGGGTTGCGACGAGGTTCAAGACGTGACTTTTGCGCACAGCTTAGTCGGACTTGTTCAAGATCTCAGCGATGGAT
TCTCGGTGCGCGAGGCGCAAAAGCTTGTCCGCATGGAGCCCTGGAACCCGAATGTGTACGTGATTGCTGGCGCGGCGCTGCTCAAGTGCAAGTCCACCGA
AGTGGCTGCTCTCGTGGCTGAACGCGGACTGACAATCGCGCAATCGTCTTCTGCGCACGAGTTTGAGCAAATGCAATTGCACTGGCTGCTGTGCGTCTGC
TATGCTCGTCTGGGCGAACGCATTAAGGCCGCGAGCCACTGCTCTCAAGCCCACGAATGGCTTGTTAAGCAGAAGCAGAACAAAGAGAATGATTCTGGAT
TAGTCGAGTTGGAATTGCTGGATGCGCGCGTCTTGTCCGTCATAAAGCCAGCTGAAGGCATCGAAGCCTACCATGCGGCTCTGAAGACCGCGTCGAGTGT
GCCCCACTTGAACCACCGCGTCGTTCCCATTCTGACGGAGCTCGGAGGGGTCTACGAAGAAGCGAACTCGCTGGATTGCGCGTTGCAGGTGTGGAAGTTT
ATCTCTACGTTGACAACGTCTACTGCTTCTCTACCTAGTGTCGGCCATTTCCTGGCCAACCTTCGCCTGGCGATGGTGCACGGCAAGAAGCAGAACACGA
AGACTGCCAAGAAGCAGATCAAGAGCGCGGTGGCTTTGGCCTCGACCAGTGAGGACTCGAAGCAGGCGACCGTCACGTCGTTTGTCGAAAGCGTGATTGC
GAAGATCGCGTAGAGCACGTCATGTGAACGATAATGGTGAGCGAAGAACTACGTGAGTTGAGAATCTTTCTATCGTTATAATTTTGTGTTGTCAGTAGCT
TGAATCACGATCACATGGTCTCATCATGCGCGCCTAAGGATTGGAGCAGAAAGTACTCCTCGTTCGGCAACAACAGGATCGTGTAGTGGTTGCTGCCATT
CACGAGGTAGCCGTGCTCCCGCGTCTGCTTCCCTTCCCTCTGTTGCCACGACGCGAGTGCGTCTGGGAACCCCCAGACCATGACTGCTGCCCAGGCCACT
TTGCCCGACTTGACAGCCTGCGCAGCCTTCTCAAACACGTTCCTGTGGCAAAACTCGGACGTGATGAGCCCGCGCCACCGCACATTCACGATCTCACCAC
TCGACTGGAACTCGAACATGTCGGGAATGCCCGTGAACGTCGAGACGTATTCTTCCGGAGCCTGTTGCTTCAGCAAATCCGTCAGGCGGCACGCTACGAG
ACCAAACCAATCGTACGCGCCCTGTAGTGACGCCACGAGCTTCGCTTTTCTGTCTTGAATGCTGGCCTCGTCATTGCCACCACCCGTGTCAATTGCACCG
AGGCTGCTGTAAAATTTCTCAAACTGGGGTACCACGATGTCCTGGAAGTGGGTCCACTCGCCGTTGAGCTCCACGCGCTTGCGCTCAATCGTATCATCGT
CTCCAAAGATGATCGTGCGCGCTGATCCGCGCTCATTGTACGCGCACACGAGCATCTCGAGTGGCGCAAACTTGATCTCGAGACAGTTCACGATACGCTC
GCGAGCGTTCTTGTCCTTGTCGTTCTCCGAGGTGAACATCTTCGCCTTCAGGTCCAGCGTGACCATGTACCGCTGCGCGCGACGCGCATGCTCTGCTGCG
GATCTGCACTCCGCCGGGATCGTGTGCCCGTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAGA