Description :
From Genome Similarity Track
Location :
scaffold_13:1903280- 1906531
Transcript NameFunction/comments
Plaha_PHALS_06493Predicted membrane protein
Plaha_PHALS_06494rna-binding protein

Sequence
3251 bases(100 bases per row)
GCCACCTGCACCTCATCCCTTTCGACTTTCGGATTTCTTTTATAAAGAAATTTTTGGAGTTCATGACATTAAACAAAGTGATGATGTGCATCAAGAACGT
GTCcagaatttttttgttgTGCCGTTAAATACTGAACAATTATTTCTCTTTGGTGTCTTATTAGCACTTGATAGTTTTTTGTACGTCTTTACGTACTTAC
CACTTCGAATGTTCTTTGCTTGTGGATGTGCTGTGACATCAGGATTTCATGCTCAAGTCTTTCGTCGAACACATTTTTATGATTTAATGGTTGCTGTGAT
TATTGGAGTTGGTACTATGGTGTTAACATACGTGGATATGTCGCGAGTATATCATGCAATACGAGGTCAAGCTATGATTAAACTTTACGTTTTATTTACA
ATGATTGAAATATTTGATCGTTTATTTTCCTCGCTTGGACAAGATATTTTGGATTCGTTATATTATACCGTCAAATATCATCCACGTCGTATCACTCGTT
TGTTTCTCGATTTTACTGTTGCAATTACTTACGTGGTTTTACATGCACTTTTACTCTTTGCACAAGTTGTGACATTAAATGTGGCAGTAAATTCCAGTAA
TTCGTCGTTGTTAACATTACTCATTTCCAACAATTTTGCGGAACTGAAAAGTTCGGTATttaaaaaatttgaagaacAAAATTTATTTCAAATTAGTTGC
AGTGATATTGTCGAGCGCTTTAAATTATTGACAATTATTGGGCTCATTCTTTTGCAATCATCAACTCGTGATGTCGCATGGGGAACGGTACGCAATGTTG
TTTTTGTTATATTGCAATACCTTAAAGCCTAATTTTTGAATTATCTTTCGTTCTAGGCTATGGTTTTAGTAGCTGAAATGGTCATTGACTGGCTTAAACA
CGCATTCATTACGAAATTTAATCAATTGCCACCAACAATGTATTCAAAGTTCATCACAATTCTTTGTCGTGATTTAACAGGATGGAAAAGTGAAGATACG
ATCTTAGATCATACACATCATGTATCGAAACGATTGGGCTTAATGTCCCTTCCATTGGCTTGTGTTGTCATACGTATGGTCTCCAAAGCTTTAACGGATG
TTCCAATCACATTCTTCTCGTTAAGTGGAAGTTTCGTGCTGATTGCTTTTTTTCTATGTTTGGCAGCATTAAAAGCTTTCTTAAGTTTAGTTCTAATGAT
CTATGCTTGTCAATCTGGTCGATTAGATGATACAAGGCCAAAGAGTCCACGCTCTATTCATCATCTTGAATCTATTCATCGGTACAATTCATAAACAATA
TCAAAACTTTTTCATTATTGTTTTATTGTCAATTGTTTTATCGTTAAGCACCTTGTTAACGCTTTCGTTAAGAGTGGTGGCTTACTGATACAGCATACGA
TTCGTCTTCCTGCCTTACGAGTCCACTCCTACCAACGCTCTTCCCTTTTCCTTCCCTTTAATACAAGTGCCTACCACATGCATGCtttctctttttcttt
tctacAACTTGGCCAAAACTTCCTCCACTTCTTCTACCTCTTATGCACGACTTGTAGCATTTAATCCCTCACTAACCATCCTGACATTTCCTTCACTACT
ATGCATACGAGTGTCTCGCgtttgaaattgttgcattTCATCGATTCCAGTCCCATGGAAAGATTGTGAAGGCAAATAACTTGTTCCAGTGACACTCAAA
TGATTCATCGTAGAATGAGTCGTAGGTTCATATAATCCATCGAATAATCCTCCATCAAGACCCATGTCCATCGTTGGAAAGCGCTTAAGAATACGTGCAG
TAATCCGACGTCCACCAGATGTATTCTTCATTGCTGCTAAATGAGGACGAATGGCTTTCACAAGCAATAAACATTGGTCTTCAGCACACACACATAATGC
TCGTTGTACAACATAATTGGCAAATTGGTCTTGTAGCATCTTGTTTAATTTCAAACACGTAGTAATTTCAGCAATATACTGTTGTCGCACACGTTCCGGC
GCTTTTTCAAGACACTTTTCAATCACATTCGAGCTAAATTTTTGAATCGACAATTCAAAAATGTGTCCCAATGGCTTAAGAATGACACCATACGCTTCTT
CAGCAGTACAAGAATCCAAAACATATTGAACGACATAATTTCCATAGGGATCTTGCATTAATTTCATTGCCTGTCGTTCCACTTGTTCAATCACTTCAGT
CTTTTGTCGCTTGTTAGCAGCATCAAGACAACGTTGTAATACACAACAACCGTGACGATGTGTCCCAACTGTCGTACATTCTTGACACACTGCATCAAAA
ACAAATTGATTGTACTCGGGTTTCATAAATTGCAAAGCTCGTTGAATCACATGATTCCCATTGGAATCAATACACAATCGTACAGCATCATCTTTCAAAG
CTTCCACGATTAAATCTGGCAAACTCGTTGTACGACGTGTTTCCGATTCTCCTTGCGATGCAAATCTCATTTCTTCACAATCCTCTTCATGATAATCATT
CTCAATCACATTCGGTGATAAAGCACATACTTCCACCACCTTCTGCACTGAACGTGTTCCATGTAAATTTAAAGCTGCAGCAACAAGATTGGAACTGACA
CGACGAATAATTACCAGTCGTTGAGTCTCTTTCACACGTTCAAGTAATTTTTGAAAGAGATAATTACCAAATGGATCCACCATCATTTCAGCCAAATGAT
CTAGTGATTCGTGATAAATCACTTCACAAAGATCAGTACGATCTTCATAATCAAGTTGTTCTTGCAATAATCGACAAccattttgatcttttgacaTGGT
AAACACACGATTTTGAATATCTTCAACACTTAAAGCTGCACTTAAAGTGGACGAATCGGTCGTACAAGCACTAAGAATTGACGTATTGCTAGTCATCAGT
GTACCATTCATTCCAGTTCCATTTGACGAATCGGTACGAAAATTCAGACGAGATTGTGGACGTCCTGAATATGGTACTTGCCCCATATCATCTCCATGAT
GACGTGGTGGTGGCATCATGTGCGATGGAGGTGGTAACATCATTCGTTGTGGATACAAAATTGAGCTAGTCGTACGTACAAGCTCAGGCGTTGACCCATT
TCCTTGATGTATAAACTTACACTTGTTGCCCATTCGACAATGTCCTTGTAAGAAAAACTTACAATGTTTCATACCTACATGCATTCCCATGCTTTTACGT
GGTGAATGTGGTGGACTTGCTTCTGGTAATGGCGGACTCATGCGTGCGTAC