Description :
From Genome Similarity Track
Location :
Scaffold_1123:1903- 7638
Transcript NameFunction/comments
g17590.t1hypothetical protein
g17591.t1hypothetical protein
g17592.t1hypothetical protein

Sequence
5735 bases(100 bases per row)
TTGTCCTCGACATGGACGATCGATACGATCTTATCCTAGGCATGCCTTGGCTTACTAAACATGAGCCATGGATTGATTGGCGAAGTCGCACCATCGGTGC
TAGTCACAAGCCCCTCGCGGACAGAGCCCTGGCGGGTCATGTCCCCTCCTCTTCCTGAGACGGGTTTGTGCTGTGCCACGCGGCGAACGGTACTTTGCAG
GTACTTCGGAAGTACTTGGACTGCCTTCGGCTATGCCGACCGCGAGTTCTACATCCTCGAGAGCTTATGTGCCTTCGGTGGGTGTGGGAGAAGCTATGGG
ATTTTTGTGCGCTCCTCAGGATGAGGCTCATGGGCTCATGGAACTCTCAAGAACGAGAACGTCGCCTTTGCCCACGGGGCGGGCGGCATACAAGGCGTCC
GAGCTGCGGCAGCTCACGCAAGAGAAGACGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGC
GGCAGCTCACGCAAGAGAAGACGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGCGGCAGCT
CACGCAAGAGAAGACGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCGCTACGCAAAGCGTTCGAGCTGCGGCAGCTCACGCAA
GAGAAGACGCTAGAGCTGGCACAACTACAGCGGGACTACGTCCAGGCGTAGTACGCCGCATTGCAGACCCCTCGGAGAGGGTGGTCGGACCAACGGTATT
GGACATGCTCACGGGCGAATACAAGGACGGCGGGAAGTTAGCTGTTCTGCCCGCGGTAGCAGAGCTACTGGAACTCGAAGAGCTCTCGTATGTCGAGTTT
CTCGACTCTCTGAAGGCGGGCGTGCTCGAGGAGATGGTCCTGATCCGACGCGAATTCGATTCGATCGAGCTCAACACCTCCTCGGTCATGGACCCCGAGG
TGTTGGAAGACGAGAGGACCTCCTCGCGGCAGAAACGATATGGCGCGGCCATTTTGAAAGACCCGTCGGATCCGTACTACCCCCTTTTGAAGGAGTTCTC
GGATGTGGTCAGCGATAACCCACCGTCGGTGTTACCTCCAGATCGAGGTGTGCGACACGAGATCGATTTGGTGCCGGGCACCAAATATTGCACCACGCGC
CAATGGCCACTACCGAAGGAGCAAGTCGATGTGATCGACGCATTCTTCGCGGCGAAATATGCCGCGGGCATGGTGCGCGAGTCAAAGTCGCCGCACTCGT
CTCCGACGTTTTGCGTGCGTAAACCCAATGGGAAGTGGCGTATGGTACATGCGTTCAACAAGTTGAATGCAGCAACCATCCCGGCGTCCACGCCAATCCC
TCGCAAGGACGTGTTACAGAACAACATGGCGGGCTGCACCATCTTCAGTGCACTCGACATGGTCGATGGCTACTATCAGCTGCTGATGCGGGAATCAGAC
GTCCCGCTCACAGCGGTGAGCACACCCAGCGGGATGCTGTGGGAATGGCTCGTGATGCCCCAGGGGCTGTCGAACGCACCAGCCACGTTCAATCGATTGG
TGACTCAACTCTTCCGGCCGATGCGGCAGTTCGTACAGACGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGACAAGACGGCTGTCGAAGT
GCACGTTAACCACCTCCGCGAGGTATTGATGTGCATGCGCGAGAATCGCTTGTATGCGAACATCAACAAGTGTATCTTCGGAGCCGAGGAGATTCCCTTC
TTGGGATGTTTCCTTGGCAAGGATGGTGTCCGTGCGGACCCTGAGAAGATATGCGCGATCGCACAATGGCCAGTGCCAGTATCCCAGAAGGACTTGCGCA
AGTGGCTTGGCCTTGCCAACTACTTACACAAGTACAGCGCCAACTACGCTGAGATGGCACGGCCACTGACGAACCTCTTAAAGAAGGAGGCGGAATGGTC
GTGGAACGATGAAGCCCAGCGGGCTTTCGAGGCAATCAAAAGCAGCCTGCAGAGCGCTCCGATTTTGGCTTTGCCCGACGATGATCGTCCTTTCAGTGTG
GTATGCGACGCATCCGACTTTGCCATAGGCTGTGCCCTTCTGCAGGTCGATGCCGATGGCAGAGAACGGGTAGTATCTTTCCAGTCGCGCCAACTTAAGG
CGGCTGAAAAGAACTACCCTGTCCATGACAAGGAGCTTCTGGCGATGAAGTACGCGCTCGTAAAGTTTCGGGTACACCTGCTTGGCAGCGAACCCTTCGT
GATCTACACAGATCATGCGTCTTTGCGGACAGCGACGTCGTCGCCCCACCTCTCCCAGCGTATGGCGAGGTGGCTCTCCTTCTTTGCGGAGTATAACTTC
ACGGTGGAGTACAAACCAGGGAAGCAGAACGTCCTCGCGGACGCGTTGTCCCGGCGCCCGGACTATGAGCTGGCGCACGTTGCGTATCTCGAGTCCCCAC
TCTATGAGCTGCTACGCGAGGCGTACGCAGAGGATGACGATCTCGCCGATCTCGTAACTTCACTGAAGGTGCCTGAAAAGGCTGTGAAACTCACAGCTCG
GCAGCGCTCACGGTTGCACCGCTACTCACTAGCGGACGGTCTCCTCTACTATCAGGTAGACGAAAGCGACGAGCCCCGTATCGTGGTTCCCAACGACGAG
AACTTACGTCATCGAGTCCTCTACGAGGCACACGACACGCCGCTCAGCGGCCATCTTGGCCGAGAGAAGACGTATACGTCTGTGGCGCGCAACTTCTGGT
GGCCACATATGTATAAGTGGGTGCGCACGTACGTGCAGACGTGTGAGACGTGCCAACGCGTGAAGCCCGCCCCATCGTCGTCGGCTCCATTGATGAGCTT
GCCGGTGCCGGCTGACTGTTGGCGCTCGGTGAGCATGGATTTCATCTTTGAGCTTCCGGCGGACACGCGCGGCCACACTGGCATCTTGGTCTTCGTCTGC
CGACTGAGCAAGATGGTGCGGCTTGTCGCGGTGAAGAAGAGCGTGACGGCGCCGCAAGCGGCACAGCTCTTCGTCGATAATGTCTTTCGACACCATGGCC
TCCCGGAGGCGTTCATGAGTGATCGAGATCCGCGCTTTGTGTCACACTTTTGGACACACTTGTTCCGTCTTCTCGGTACGAGATTGGACATGTCCACAGC
GGACCATCCACAGACCGATGGTCAGACGGAGCGCGTGAACCGAGTGTTGGAAGACGTACTGCGCAGCATCTGCACTGAAGACCCCACCAAGTGGAGCACG
CTGCTACCCCAAGTGGAGTTTGCGCTGAATAATGCTGTGCATTCGTCGACGGGTTTCACCCCATTTTACGTAAATGGCTTGCGGCATCCGCGTACGCCGC
TATCGTTGCCACCGGCTTCGAGATTGGGTGGAGGAGAGGCTATCGCCGAAGATTCGCGTGGCCTTCAAGGCCTCCGTTCGTCAGTCAAACGGAACCTCCT
CACGTTCATCGAGACAAGTGAAGCAGTACGACAGCGCGTCCGGGACGCTATGGCGGCTGCTCAAGACACGCAAAAGGAACACAGTGACAGGCAAGGGCGT
AAGAACACGCACGTGTTTAAACTTGGGGACCAGGTCCTCTTAAACGCTAAGAATCTCCCTATCCAGGCAGTCACTGCGGTGGGCAGCACCAAGCTTCGGC
CACGATTCGTGGGGCCGTTCACGGTCATTGGGGTCCACGGCAACGCGTACACGCTGGACCTGCCATCGGCCATGGCCACGCATCCAACGTTCTACGTGGG
CTTGCTCAAGCCTTATCGCCCGGCTGAGGCAGACGACTCTGAGAGTCCGACGAGTTCGAATACTGCCGAAGGACGCTCGCCATCATCTGCATCAAGTCAG
CTTGGGGTGGGGCTGGAACAGCCGGCGGAGCAGCGGCCCTCTGAGGGGTCTGATCCTCCAGTGCGCCCACGCGGGCATAGAGCTGTCGGATCCAGTGAAG
ATGATCCCGAAGGGCACCGCGGTCCTCCTGAAGGGCTCGTTCGCTCTCCGAGCAGCGGTGGGCGACCTGACGAAGCTCCTGCTCGAGGCCATCAACCCGC
TGTTGCAGATCATGCGCTCCGCGCTCGAGACGACCTAAATCGTGAGGGACGTCCCGTCTTGACTCAACAGTCGACTCGACAAGATGCACGCGACCGCGTA
GGGACACAAGATCCGTCCGTTGCATCTCCAGCAGCCTCTGGCAGCCCTCCACAGCAGTCAGGAGGCTCCCCCGGGCCGACGAGACGTCTTTCGCCGAGGT
GTACGACGTCGACGAGTGACGCGAGGCGTCCTGGTCCGTCGACACGTCCGTGGCGTCCCCCGCCCCCACTGATTGGTAATGAGGGCGCTCTCTACTATCA
TGTCGAGAGGATACTGAAGCGCCGCGGGCGTATCGGTCACTACCAGTATCTGGTGAAGTGGCGCGGTTATCCAGAGGATCAAAACACGTGGGAGTCTGGA
AGCCGCCTCTCGGAGGACTGCGCCGACCTCGTGGACGCTTATGAGCGTTCCCACGGAGCCGGTCGGCGCTAACCCGGCCAAGAACACTTCGAGGTTCTAT
CGGCTGGGACTGCCAGGACTTCTGGACCTTCTGAAGGACCTCCTCGAGGATGACCCCCGGGGGGGGCAGGTTGCGGTCGAAGCTGCGGATGCGCCACTGG
CCGTCGACGACCATCTTCGCCATACGAAACCGAAGACGTCGGTGGGCGAGCCAATCGAGGCGATACGGAGAAGCCGGAAACTCAGGCATGGGATATCCCA
AGTGGCGGAGCCACTGCGTGAACTCAAGTTCGTTGGATTGACGGGCCAGGCCCGTGTCGTCATACAAGACGACCGGACACTCGTCGTAGTGCGGCAACCT
GTGCCCGGGTTCCCGACTCCGCCGGAGATACTCGCTGTAGTCTCGGAAGGACCAGTATCGCAATGCGAGAAGTTGCTCTCGCGTTCGAGGAGTCGCAGAC
TCGTGATCGCGCTTCGAGTCTCGGCGCTGCTCGATGGCGACCTTCACATCTCGAGCGCGCTCGCTGAGATGTTGTCGGTTGTCGCGCTGCAGCAGCTCAA
GCGGGACGTCGTCTTCACTACAGACGTTGGTGATGACTTGCGGTTCCCGCTCGGTCGATGGGATTCGACGCGCAGGCTCGGCCTTCGCTCGCTCCGTGTT
GCGCTCAACGGCAGCCTTGCTGCGAGGAGTCATGGGACTCCCTGGATGGAGAGCGCGTTGCTGCTCCGTGAGCTTGGGGGAAGCATTGGGGTCGTTGACC
TCCCCTTGTTCGAGTCCCTTCTCGGAGTCCGACTCGTCGTAGTCGACCTCGTTCGAGACGTCCTCCGGAGGCGAACGCTTCGCGTCCCGAATCGGGCCTT
GATCAACCTCCATCTCCGTGACGGACGAAGTCCGATCGGCGGCAGCCTGCCCATCGCCCGCAGGTTGCGAATCAGGGGCGTCGTGCGCTGTGTGAGCCTC
TCCTTCGTTTGTCGAGTCCCGCGGGGCACCCGGCTGGGTTTCATCAGGCGTAGAGGCCCGCCACTAGCTCTTGTAGTTTCCTTGCCGCTGGCCGAGGTCG
TTGGAGGCGTTGCCGTAGATGCCGACGGCGTATGCTGGTCGTCCGCTCCTGGAGCCTCCTCCATGTCGACATCCGGGCAATCCTCGTCGCCAAGAATGAG
CCCAGGGTTCGTACAGTCGGTGTCCGACTCGCTGC