Description :
From Genome Similarity Track
Location :
Scaffold_524:1903- 4819
Transcript NameFunction/comments
g12178.t1hypothetical protein

Sequence
2916 bases(100 bases per row)
GAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGCCGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGAT
CTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGACGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAG
GACAAATGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGATCTGTGTCAAGAAGCCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAA
CGACGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGAC
GGGTTCTATCAGATCCTCATCCGTGAGAGCGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGC
TGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTTGACGACGTGTTCATTCACAG
CCCGGCTGTGAATGGGAAATCGGACGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAATCTGAAG
AAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAAT
GGCCTATGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCTCT
GTTGCACCTCTTGAAGAAAGATGCTGCACGGGAATGGACTGCTGATTGTCAGCAGGCCCTTGAAGCAGTAACGCAGGGCTTGACTGAGGCGCCGATCTTG
GCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATC
GTGTGGTATACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGGACTCCTTGCCATGAAGTATGCACTCGCAAAGTT
TCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCCCAAAGAATGGCA
CGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACATACCTGGAAGGTTGAATGTCGTGGCCGACGCACTTTCGCGTCGACCAGATTATG
TGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCTGCATACGCACATGATGC
GGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCTCGTGTACACCGTTATCGTGTA
CACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAAAGCAGATCGCATTGTCGTGACGGATGATCATGAGTTGAAACTCAAGATCACGTACGAGTATC
ACTATGCCCCGACCTCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCACATGCGTGACTTCTATTGGAATCACCAGTACAAATGGGTACGCAAGTA
CGTTCGTGCTTGTGAGGTATGCCAGCACGTGAAGCCTGCGCCCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAATCCATTTCAATGGACTT
TGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATAGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAG
GTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCATGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTG
GCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGGCAGACAAACAGAGCGTGTCAACCGCGTGCTGGTT
GACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGTGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGAC
ACACACCATTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAAATC
AAAACAACCGGATAAGCACGCTGATACAAGCAATATATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAACACAGTGTCTACG
ACGGGCGTAGACACTTCAAACGACAACGAACAACACGCGCAGGCCGGGCCTGCTGCGAACAAGAAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAA
TGGACTTTGTCCAGCGCCGACAAGCCGTAATTCGGTTTGTCCAGGACGCGATAGCAGCTTCTGTCGATCGACAGAAGCTGAACACCGACAACACCGGCAG
GGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCT
CCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGACAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTG
GGCGACTGAAGCCGTA