Description :
From Genome Similarity Track
Location :
contig_48:190296- 194692
Transcript NameFunction/comments
g8374.t1hypothetical protein PHYSODRAFT_358957
g8375.t1hypothetical protein PHYSODRAFT_253756

Sequence
4396 bases(100 bases per row)
TCTCAAACAGCTTCACCAGCAACGCTGAAGGCGACTGCGAAGTTCGCGGCAACAATCTGCGGGCCGGTGCTTCTGCCGACAGACCTGGAGCCGCCACCTA
CAGAGTCCATGGTGGCCCAATGCAACGGGACACTCTACAAGCAGTGCCACCAACCAGGCGTTGACGAAGCCATGTGCTACAGCTTACGATTCACAGTGCT
GAGTTGTGTTCACAGCCCGTTCATCATCCAAATGAGACGGCGACAGATTCAAGAACGGTGGGGGATACGTGTAACCCAGAGTTCGAGGCGTGGCTGGGCT
GCAAGTGACAGCGAGACCCACCTACCAGACAAGAATGGAAAAACGCACTTTTCATTCCTGCACAACTACACGTAGCTGTTTCATGACCCTCTTCTCAACC
CTCTGCAGATTAGTCTTCACCCCCCATGTCCGCTTCTTCTTTGCTGCCTCCGCCACCACCTGACGCCGGCAAGTCCAAAGGCTCCGTCGGGTTTGCAGCC
GGAGCTTCCCCAACCGGAGCTTCATCTTTCGAGTCCGAAGTCCCAGCCGAGCTTTCATCTTCCGAATGACTTTCAGCTGGGGGTTCGTCGTCCCAACCGA
CCTCAACGTCCGTGGACGAGTCCCCCACCGTGACGTTGACAAAGCTTCCGCTTCCGCTCCCACTGCCGTCGGATGCACTCTTTCTCTCTCGGTTCTTGTA
GCAGTTGATGTTGTCCTTGCACTTGTCCTTGTCCTTGCTGAACATGCACCACGTCGACGACTTGAGCGAGCACCAGCCGTAGCCGATTGAGTTCCAGCCG
AACTGCGCCTCCATAGCCATCGCGTCGTCGTCTCCGGTACTGACATCCAGCGTCATAGTGTCCACTGCGCCACCGTTCAACGCGAACACATCCACGGCGG
CAATGCACCCGACGAGCAACGCGGCAGCCCCCACGACCCCGAACAAAGTGCGGATGGCACGACGTCTCTGTCTCATGCTTGTTGCATCATGTTGCGCTGC
CTGCTGGTACGCAGACAGCAGCATGGCCGCTTCCTCCCCACGGTCAGCCCTCATCACGAATCCCCGATCGAGAACGCCTCCTGCCTTCGGTTCAAGTCGA
ACTATGACCGAGATATCGGAGACGAAGGATCTTTCACCACGAAGATCCACGCACCATGAGCGGCTCACAAGCGTCGAGGGTCAACGCCGAGGGACGCGAA
ACCTTTCTTGAAGATATCTCCCTTCCCGACCGCACATTTCGACACTTGTGGCCTTTCATGGGAAATGTCGGCGACTAGTTGCACTCGATGACCTAAATGA
GGTTGGCAGAGCGGGCTCGGCATCTGTTCCCTACGGTTGAGAGTAACGAAAGTGTTGAGGTTCTTGGGGGCTATAGCTTGGTCATAGAGAAACTACCGCC
ATCCGAGCACCTTCACAACCTGCACCAAGCTCCCTACTGGAATGTAGCGATTTGTCCATAATACACATTGTAGCTATCGCATCGTCGCCAGCTGAGCGAC
GTTCTCTGTAGCTCTCTTTGGTCGCACCCATTCCTCGTACGTCTTGAGCGCAATTCCCCAGATGGGGCACGAACTAGTGCCAAGGCGCCTTTTCTGCGAT
GTTTGGGCACTCTCGTCTACTAAGGTGACCATCAAGATAGAGAAACCCACGATGGAAACTACTACCAAGTAGTTTCGCTTGGGTATATCCTACGCTTCCT
CGCTACTTTGTGGGGGCTCCAACTCATTTTACTGGTGAAAGCAGAGCGTAAAGTTGACGTGTCGTTGTATGTGGTTGATCTTGCTTCAAGTTGCTCCGAA
CGGCACAATTGATGTAGTGATGCAGACGCGGGAGTTCAGTGATGGATTTTCTGGTTGCTTTTACGCGTTTGATACTTTCGACCTTTGGCTTTCTTGTATT
GTGCCTCACAGTTCTCGGGAATTTTTTTGTGGTCCACCACTCTCCCAAGAAAAACTGGATATGACTGCTTTGGGTAATGCTCCGGGGCAAGCGTGACATC
AATCTCCTGGGTAAAGTTTAGTCAAAGGGAAAGGAAGAATCGACGAGTAGCTGCTCATTTGTCCTCTGACTCAGGGTGACCAACATTGGCATGCAAGTAG
AGACGGAAACCGCATCGCTGACCACGGCCAGCGAACGAGGCTATACAAGCAGCCAGCGTGGTCTTCCGTCTGTGCACTTCGATAACTGCACAAGATTGCT
TCGGGCCTGCGTACAAACCGCATGTAGTAGGATGTATCTACATGGTAGTCTCGTCGTCTGGAATGTTGGCCTCACCAATGCGGGCCGGATCCGTACCGCG
AAGCTCGTCAAGGTTTGCTCGTGGAACCTGACAGAGAGTAGAGGTGCGTGACCCCATCGTCCGAAGGGATTTGAAGACTCGTCGAGCATCTCGAATATCT
GCATTTGGAGAACATGAGTCATGATCAAGTAGGTTGGTGGACATGTTACATGGCCACCAATCCCTTTCTCTATACAATTTGTGGAAGCAACCTCCAACGT
ACATCGTATGATATCTTATAGCTAAGTGCTCTCCGCCAGCCTCGGTGATTCACCCCCATTGCGTGCCTGGATACTAACGGGTGATTCACAGCACCAGCAA
TTTGGGGGAGGTGAAGGCAGTTTCAACAACCGTCGGCGGGAATGAAAGCAGCAAGAGGGAGCGCTAAGTTACATGTACACAGGAACAACTGTACTACCTG
CTACCAACACAAGTCACGTTGCGATCGATCACTGAAGTAGTACACGAGCTGCACTGACAACGGTAGAAACGGGGGTAAAGTCAGTTACTGTACTACTGAA
TTCAACTTTGTCGATCACAGTGGACCATTGTGGCACGATACGATGCGCCGTATGAGCTTGCAGACCAACTAAGGCTGCTGCACCGAAAGAAAAAGAGCTA
ATCTCATCCAACGAAAAGCCTGACACAAAGGGAAGTTGGACAGTAGTCAGACGAAAAAGGAAAGTCGTCAGATAGTAAAGCTCTGAACGAACGCCAAGCT
TCCTGGCGTCCAGAAACCATAATGGTTAGCTTGTTGATGCGCCGAAGCCACGTCTAAGAGTTAAACAAATGGAGCGCTAAATGGCACGCGTTCTATCAGG
TATGTAGGACACCCTTGACATTCGGGAACGAGTCTTTTCACTTCCCAATCTGCGGCGGTCCCTCGACGCGGTCTCTCAAGGTCTGACAAATGGCAGCTCT
CGCTCATTCCACCCTGCCGTCCTTGTCTCCGGTGCCCAGACCCTACAGCATGCAGAAGATGGAGCGCCGACCTCCGATTCATCACGCGTCTCGCGACTCG
TTCGGACGTGCTAGTATTGGGGACAACCAGGATGTGTACATCGGAGAAGGACTCATCGGCCCCAATGGCATGGATGATCTAGACGAAGACGCCCCTCACA
AGTCTCACCACCACGATCGGAAACATCTCGACTATTTGGCGATCGACATCGGGGAGAAGTACCTCGACGACATGTACAAGGAGGACGACACCGACGACGA
CAATACCGACGGCGAGGAAGGAGGATTCCTCAGCGACGGACCTCCGACGTCAAGTTCCTATCACTCGATGCAGCGGGCAGCAGTAGTCAAACCGGCCGAA
GTCGACTCGGTTCTGTTGGAGCAGATTGAAGAGGAGGAGCAGGCGGAACGCCACCGAGTGGAGAAAGACGTGGCGTGGCAGAAGGTGAGGCAGCTCCTGA
TTGAGGAAGAAGAGAAGGCGGCAGGTCGCAAGAAAACACGGACGTCTTCTGGAAACGGCGAAGACTACGGGACCGTCAAACTGCTCGACTCGTTGACGAG
GACGGGGAGTGATGGGGCTCACTGCAACAGCAGTGGATACTCGGACGCGACGCCACGCGCGAACAACACGCGGCTGGTTCCCCACCCGAGAGATCCGCCA
CAGACGTTTGCGCGCCACATCGGCAGCCGACTCGCGCATTTTCTGCATGGGGGACCAGCCTCGGTCCACGGAAGTGCCGGCTCTCACTCGTGGCGCTCTC
AGTCCTCTTCGTCCAGTAGCGATCTGAGCCAATCCACGCTGCTGGCGACGCTGGACGAGGTGACCAAAGTTTGCCAACGATCGGAGCTGTCGGAGCTGTC
GATCGCGCAGATCGCGTCGCACTTGACTTCGATCGACCAGATCGTCCGCGAGGACATCGCCAATCACCACAAGAGAGGGTCGCGTCGACTGTCGTGCACG
CAGAACACTTACGACTCGAATGGGTACGACATCGAGTACCGAGTCCCGACGTACCCTCGGATCGTCGGGCGAACGTGGCGCCAACTGTACGCAACTCGTT
CAAGGCGTTCACTGCAGCCCAAGATTTGTGTGATACGCTGGCCGCTTTCAACAACCTCGTGAGAGATTGCGGCCTCAACGGCGTCAAGGTGGACGA