Description :
From Genome Similarity Track
Location :
contig_105:19028- 23425
Transcript NameFunction/comments
g13570.t1hypothetical protein

Sequence
4397 bases(100 bases per row)
GATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAG
TCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGC
GAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACAAGGAGTGTCGGTCCCTATATAT
TGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGG
GACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATAC
AGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGG
TGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTG
CATATAGGTTCTTACCTTAACGAGCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGTACCAGCAACGCCGGC
GAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCGTTCGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTT
GATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTAT
CTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGA
TGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAAC
CGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCG
GTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAGTACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTT
CCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAG
GCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCATTGCCAACGACCCCTGGGAGACGCCCCAGAGGGT
CGACCGAGGCCGGAATATTTTCGGCCCAAGGTGCGACGTCGACGTATTTCCAAGACTCTCACATGGTGACGCCAAGGTCGGCCAGTCGTACAGAGCGACT
GGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGACGACTCATCTGAC
GAAGATTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGTTGAGCGCGGTGGAGAATGACAGTGCGACAC
CGAGGCTAGAGATCGCCACGCACCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTT
CATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTG
CCCCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGG
CCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGC
AAAGGACCACGTCGAGCACTTCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGAT
ATGATCAATGATATCCTTCGTCGCAGGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGG
ACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGTCGCCGG
GATGACCAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGCAGACACGCGTGGAGGAT
ACCCGGAAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGA
CGGATACGCGTCGACCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGT
CGGCCGAGGGCAAGTAACGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCG
CCTGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACT
CACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTG
AAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGA
CTTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGGA
GTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGG
GGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGG
AGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCA
GGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGTTATGGATCACAGTGCAGGAGT
GACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCCTGG
TGAAGTCGCAGAACCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATT
TAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGGGGACAG
CCGACGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAG
GGGATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAA
ACTCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTG