Description :
From Genome Similarity Track
Location :
Scaffold_134:19025- 20051
Transcript NameFunction/comments
Phyra_41309DEAD/DEAH box RNA helicase, putative

Sequence
1026 bases(100 bases per row)
CCTGCACGTGCTGTACGACCCACTCGGTGCACGAAGAAGTTCGGGTCCTGCGGCGGATCGTACTGCACAATCCAGTCTACATCCGGCAGATCGATACCTC
GGGCAACGACGTCCGTGCACACCAGCAGTCCCGACTCCAGCGACGAAAAGCGGTCATAATTCGTCGTACGCTTTTTTTGAGGCATTTTTCCATGCAGCCC
CACAACAGGGATGGCTTCATCACCTTTGAATAGCTCCTCAAGCACGCGTGTGAAGAAGTCCACTGAGCCGCACGTGGAGAAGAACACAATCAGCTTTTGG
CCCTTCTTGGACTGCACAAAGTGATGCAGCGCTGACAGTCTCTGGTCGTGGCCCACCAAGCAGTAGTAGTTCTGCAGCGTCGTCGGCGTAACCTGCGTGT
TGTTCGCCACCTGCACGGAGATCGTTGCTGGGTTCCGCAGCCCTGCGCGTGCCAGCGCCTTCACCTCCTGCGTCTGCGTGGCCGAGAACAAGCCCGTTCG
TCTCTGCTTGGGCAGGTGCTCCAGGATCTTGTTGAGACTCACTTCGAAGCCCATGTCCAGCAGCGTGTCGGCCTCGTCCAGAATGAGCATCTCGAACTCG
CGCGTTTCGACGCTGGAGCCGACGCAGCGGTTCAGCAAGTCCTCGGTTCTGCCAGGCGTGCCGATGACCACCGAACACTTGCCCACCGCGCCGCGGATGA
GCGACAGGTCCTCGTCCACGCTGGTGCCGCCCACGAACAGTAGCAGCTGCACACCGGGCAAGGCGCCAGCAAAGAACTTCTCGGCGCACTCGAAGATCTG
GCGTGCCAGCTCGCGCGTGGGCGACACGACCATCGCCACGAGCTTGGTGAGATCGGCGTGACGCGGCGCCGTGATGCTGCCGTCCGCCAGCTTGGCCTTG
AGCAGCTGCACTATAGGCAGCACGAAGGCCAGCGTCTTGCCACTGCCCGTGCACGCGTCGACGCACACGTCTTTGTTGGACAGGAACAGCGGCAGCGTGG
CGGCCTGCACGGGCGTCATGTGTTCG