Description :
From Genome Similarity Track
Location :
Scaffold_4:1902000- 1921141
Transcript NameFunction/comments
Phyin_T30-4PITG_03473Callose synthase%2C putative
Phyin_T30-4PITG_03474Putative uncharacterized protein
Phyin_T30-4PITG_03475Putative uncharacterized protein
Phyin_T30-4PITG_03476Putative uncharacterized protein
Phyin_T30-4PITG_0347760S ribosomal protein L7a-2
Phyin_T30-4PITG_03478Putative uncharacterized protein
Phyin_T30-4PITG_03479Putative uncharacterized protein
Phyin_T30-4PITG_03480Putative uncharacterized protein
Phyin_T30-4PITG_03481Putative uncharacterized protein
Phyin_T30-4PITG_03482Putative uncharacterized protein

Sequence
19141 bases(100 bases per row)
TCGCGTAGACTACCCAAGCAGCGGTTCCACGCCATAGCAAAGGCAATCGTACGCTCGAAGTCAGCGCCAGACACACCGGTAACCGATCCCAACTGGGACT
GACGGCCACTTGAGCTGGCGTCATCCTTGTCATTGGGAGTCTTCACCTCGTTGTACAAATGATCTCCGTTCTGATCCAACAGGTTCGAGTACATTTGGGC
CTTCACCGTAAGAGGCTTGATGCCATCAGCCATTGACACACGCTCAAAGTGGCGGACAGGCATGGTTGATTCTTCCGTCTCTCCTTTTTTCTTTTTCTTC
TTCTTCTTCTTGCCATCAGCTGCGCCATCCTGGATGTTCGGGACAATCTTCTTGTTGAACATACGAGGAATGGACTTGAACGAGAGTCGCAGCACGCGGA
ATGAGCGCAGCTCACCGATACGGAGGTTGAAACCAGCAAACGAACCGAAAATCACCGACAAAACCGAGTAGAAAATCTGCGCGTCGTACATGAACACAAA
GAACGCCGGGATCCATAGGAACAAGATGTAGATGATGTTGTGGAAAGTCATCTGGAGGATGAAGTTGGAGTACGGAAGATACTCATCCTCGTTCGCGTAC
CAAATGAACAGTGTTGTTTCCACCAGCGCCTTGATCATGTACTGGTAGTCAAACGTAAGCTTGCAGAGGAACAATAGCAGCCAAAAGCAAGTGTATCGGC
AGTACGCGCGAATGGGAACTGGCATCGACCGACCCACGTATCCGGAGCCGACACGCGAGAAGATCTTGTTGAAAAACTCACACGCAACGACGAGACCGAT
GCATCCAGCACCACCAAGCATAGCAAGACCACCCATATCCGTACGCTTGTCGTTGTCAATGTCACCGTCCGGAAGTGGGGTACCATCTCCCATTTTCAAC
AGACCGCTAAACAGATCACCGATCTTACCGTTTGTGATCAACGCCTTGATATCCAACTGACAGATCTCGCAGTTTAGCTTACCCGGACCAGGCTTCTTGA
TGATGCTCTCAACGGCAGCACGCCAGTTCACCACACACATACTCTGGTCGAATTCACTTGAAGACGAGAACGCCAGTTCGTCTTCAGTTACTCTCGTAGT
TTGGCCTGTTTCCGCAAAGCAGTTGTCAATCAGATCCAAGTAGCATCCGCACCGACCCGTGCTTTTCTCCACACAGTCCGTAAACGGCACAACCTGGAGT
AGAGCCTTGAAATCAATGGGAATGTCTTCGAAGATACCGGTCGTGTAGGTAATTCCAAGACACGTAGCCAGCATTTGGTGGTTACAGGAAGGACCGGATC
CATCGCTTGACTTGTCCTCTGATCCGTCACCAGATCCAATGCCAGTGCTGTCGGAAGCCGTGAAATTCTTACCGAATACCGTAAAACCACGCGAGTCTCC
GTTGCTCAAATCAGCGCCGTACAAAATTGGCGTGTCCGGGCAATACATGACCATGTTGAGAGCGAAACCGCAGACTGCCAGGAACAATGCGCAGTTGAAG
CAGAAAATACGACGGAAAGACATGAGAGCGCGTATCCACGTGCGCTTCTCCACAAAACTCTTCTTGATGACCTTGGGGCGACCCTTTTTGTCCACTTCGC
CGAATGCTTCGTGGATGGTCGTCGGGTTGTATTTCAGACACTTCTTGTTCCAAAAGAACTCGTTAAAGTCATCGTAGTTACGGATCTCTCCATGAGGAGC
ACGAGCACCCTGTGCGGTCTTCTTGTCGTTGTCTTTCTTGACTTCTTCGTACATCGGACGAATTACCTCGGCAAGGAAGTCACCAGGGTTCTTACCACCA
CCACGAGACGAGGCCTGAGGTAGTGAAGTGTGTAGCAGGAAGCACAGACACTCGGGCATCTGACGGAAGTTACCAGCCTCTCCCCAGATCAGGAAGAATA
GCACGATATCCACTAGGGGGTCGCTCGTGAAGGCAGGCTTGGTAGACACGTACTTGCACCACTTGGTGTAGTTGGCGAAGATGCGTCCGTGGAAGCGCTT
AATACCCTTGTTAGCCATATCCAGCTCCTGTTGTCGGTCCAGCTGGTGGTGCTCCTCGTTGTTCTGGTTCGGTTCCTCCTCCTGAAGCTTGAAGTTCGTC
AACATGAGCAGCACATGCTCCTTCTGATTGGCGATATTGGACTCCTGGAAACCGAACGCGCCCTTGAGGCTTTCAAAGATGTCACCTACCGCAGACGAGC
TGTCATAGAGAGAAAGAGAAAATATCAGCGTCAGTTTTACGCCCTCTTTACAATTTGAAACTGCAGTGGGTTTAGTCTTACTTGGTCATAAGCTCGACCA
CGGCATTATACGTGGTCGGCAGGTTGTCCATGGGCAAGATGTTGTACTTGGTGTTATGTCCGCGGCCCGTAGCGCCGCCAGCCGTGCCCTTCTCGCGCTG
ACTGCGGATCATCTTTACATATCGGTTCATTTTGCTGTTGAGGCGTTGACTGGCGTCTCGCTCTTCCTGCGTGGGGTACTCGATGGCCAACGCCTGCTCC
ATGAGTGTCACCGCGCGAGAGAGCTTGGCGTCGGCTCCAGCCGCATCGGGAGGAGACGCATTCTGCATCGCCACACCAGCGTTAACCAGCTCCATGGCCT
CATCGCAGAGTTTCTTCTGCTGGCGTAACGGCTTGCTATACTGCATAGCGTCATCGCTGTCGCCATCGCTGCCGGAACGCGCCATGTTGCGCGGGCTGCG
GGGCGTTCAAGACTGACTGAAGAAAAGAGAGAGAGACAGCGGCCGTCAAGCCGAGCCGCGGGGTCCTGTCTGAGTTCACGTGCGACTGCCCAGCTGGTAG
GGGATCTTATCGCCGATCGCGACTGGAAATGCGGGACTCGAGTCGTGTACGCGGGGGCGGCGGGTGTCGTCCGCCCGGCGTTTCTTGTCCGGACCTTTGG
CCGTCGCTCGCGATATCCCACACTGAGCCGACACCAACCGACGACAGGAGCTGCACCTCATCATGGCGCCCCGAGACGGAGTAGACATAGTATACTGAAG
CCAAGTGAAACGTGGTAGCCAAAGAAATCAGAATCCCCAGCGGGAGTTAACCCCTTACATTAAATTAAATTGAAACGGCTTGCACGTGCTAATCACGGGT
TCCAATTATCTGCATAAAGGTATAATCTTCCAGATCGCATGTGCAAGATGAAGCTAGGTTAGGCAAACAACTCGATGAGCTTTTTGAATCAGTACTTTCC
GACAGCTGATTTTTTGGCTCGAAAAGGTGCATTACACTGTTCAAATAATTTTCGTGGATCTCGACGATAACACAGTAGCAAACAGGAACTTCCTGTCAGG
AAGCTGTGGTATGTAGTGCCACTGATACGATGCCAAGTCGATCGAAGCTGCGCGACGCTGCTATCACTGTACATGAGTGTTCCAGCCTGAAATCCAGGAC
CTTACCAAGCCGCGACAAGTCAGCCATTCTGCACAATCAAATTAATCACAACAGCTGGCTTACGTGTTGTACACCAATAATCATGACGATCGGACCACTT
TCCTTTTCTAGCTATTATAATCCGTTCGCATCTCTGTGTCTCTTAAAATAGCATCTATTTTACCCTGATTAACTGCTAAAAGTTACCCCAAGACAGCAGT
CAACGTTGAATCGATTTCGTATCCGGTCCAGCAAAATGGGCAGCAAGAGGCACGATCGACGTCGTGTGCGGGGCATCCCAGGACGGGCTCTTGCAGCGCG
CGAGCGCCGTCTCATCCAGCACAAGGAAAAACAGCTCCGTGTGGTCATTATTCGCCTGCGGGCGCTGGTGCGCGACAGCAGCGTTGCAACAGTTGAAGAT
CGGGATGAGTGTTTCCGCGAAGTGCGCCGGCTGGCGATAACACCGAAAGGGCTAGTTTCAGACGAGTTCCGGAGGGATCTATGGCCATTTCTCTTAGGCA
TTGGTGAAGCAACGCACAATACGCGACCTGTCACAAACAGTGATTTAGTGGAAGTGCACCGGGATGCAGCGCAGGTGGAGAAGGACGTGGAGCGATCTTT
GTGGCATTATGACGTGCTGCAGGGAATCAAAGAGAGCGAGCGTCGCGCTAAGCGCCGTGCATTGACGCAGATCATCCTGGGCGCACTATCAGCCAACGAC
GAGCTGTTCTACTTCCAAGGGTATCATGACATTGTCTCGGTATTCCTGCTGACACTAGGAAGTTCGCCAACCACGATGCAAGCTGTGCAAAATGTCAGCG
AGACATACCAGCGCGAACCGATGCGTCCAGGCTTTGAGCAAGTGATGGCGACCACAAGGCTGTTATTTCCGTTGCTGGATGCTGCAGACGAGTTGCTATT
CCAACATCTACGGGCATCGGGGGTACGCTCTCTTACTGGAGGGTGCACCAACGTGTATGTCATACTGACACTTTCTGGTCGTGTGCCTACTACCTAGGTT
GAACCGTTTTTCGCGCTACCCTGGATGATCACGTGGTTTGCGCATCAATTGAAACGCTTCGGAGACGTTAAGCGGCTGTTTGACGTATTTCTCGTGACAC
ACCCGCTTTTCAGTCTTTACGTGTCTGCTGGGGTATGGAGTTGAGCCTAAAAACCTTTTTGAGTCTTTTCACCTTCCTTAACTTGCTTCTGGTGCTCGCT
CGATACGTAGGTTGTGCTGGAAGCAAGAGATAAAATTTTGCGGTGTGAGAGCGACTTTGGAACGATGCATGGAATGCTGTCGAATTTGCCACTCTCTATG
GACGTCGAAAAGGTGATCGCACGGGCTCTTGTACTGTTCCATCAACTGCCGCCGGAGCAGCTTATAAAGCAAAGCGATATGGATGCTGGCTCAGTGTACG
CTGGTTGATAGGCCTGCAAGCTCCCGATACAGCGCACTAAGTTCTAACCGTCTACGTTGTTGATGTGCGTGGCAGCCAAAATGCGTACTTCCGGTTTCCT
TTGAAATTCCAACCGTGGCCCAGTGTAACCAAACCAGTGCTGAAGGATGTCCCGCCACTACCGTCACGATCAAGGTGAGTAAAATACGTGTTGTTAATAG
TGTGGAGTTTCTGGTGATTTGGTGGGTTTTACATGGTTGATGCGATATCAATTGAACAGAGATGGAGATAAAACCAACTACACTTTTGGCTCTTGGCAGG
TAACTCAGCTACTTTAGCTTATTTCGACTTCAGTGGGTGTGGGTACTGAAGTGTTCTGTGATACTGTGTAGATTTCTATCATTGCAACAACCGTGATTGG
CGTCGTAGCAGTGGCTTCCGCGTATGCTTTTCGTGATCGCATTGTACTGCACGCGTGAAGTTAAAGTGCAGCAGTGATTTTGAAAAATGGTAAGGATAAA
AGACTCTCCACGATATAAAATACACGTTGTTATTATTCAGGGCGTCTGCGAGAAGCAAAACTGTCGCAGCGTAAGGCGACGATTATTGTAACGGAATACT
TGGTATCACAAGAATTCTGGTGCCCTGTCCTGTTAAGAGGACATCAGTTGATCATACTCGTAGTCTTGTGCTTGAATACGAGTGGGGTAGCTTATCATTG
GAGCACGCTCTCAAGAACTGATAGAATTAAGAGTCCTCGAAAAAGAGATACTCGCGACAAACTGGGCAATTCGCGTCACGATTGAGCCACTCGAGCAAGC
AGCTCATGTGAAAGTTAGTGCGATTCATGCCGCAGTTGCACAACGTGCGAACCTTGGGGTTATCCTTTAGCAAAAAAACAAACAAGATTAGATAGATCAC
TACCAACCGAAAAGTCGAAGTAGCACTCACCTCCGAAAATGTGTCCAAGCACATGATGCACTCGAGGTCAAGTTGGCCTTCGTCGACCTACCGTAGACAG
TATAACATGATCAGCTCGAGCACCGCCAAAAATTGAGATGGCCACACATACTTACCACACCAGTGACCTCCTGATACGAACGCAACAGCCTTGACAGCTC
TTCTGGTCGAGGTGATGGTGTAGGATAGTGGTCTGCATCCAGCCCCAGGAGTCCCATGCTGAGGCTGCGACGCATGCGCTGCTCTTCCGTCTCCTTCTCT
TCATCCTCGTCATCTTTTCTGCCTGCGTCTGCCATGAGCCCAGGCGATCCAGACCTCTTTAAGACGATCCCCTGATTACTCCTACCGCCTGAACTCGTTC
TTGACCTGGCACCAAGCAGCTCATGGGATTCCTGCACGCCCACTAAAACCTCTAGCTCCTGGTCGTCGTCGTCGTCACCTCGCTCCATGTCCACCGTGTC
TAAGTCGTCGGACTGTCGTCGCTGGTACTTGGGCGGGTGTTCCAGGCATGAGCAGTTCTGACCCATCGCGTCGATCGTCCGCACGGAGCTAATTGAGCAA
TAGGCCGCGGCACAGTGGTGTAGCGTCCTCACACCTGATAATGAACTTGTAGTCGGCAGGTGGTGTTGCAGAGCTTTGATTTTGTAACGCAAACTAGACA
TTTCAAATGTCTAGGTCTATCTGAAAGAAACATGAATGCTGATTTATCTTGTTTCTTTATTGTTGAAGTCTAATTTTTGTGGTCTAAAACCTGAGCATGC
ATGCTTACCATTGGCTAATATATTACCGTGTTCTTTGACACACGCATGAAATTTATAAAATTGTCGCGGTTTTTTAAAGCATTGTCCAATCTTCAACTTC
GATAATAATGGGCACTATTTTGCCGGCGATCGCGGCATTGCTGGCGGCGCTGCTTCTGCACGCTTCCAACGACTTTCTGCCTATGGACTCGTATGCCCCC
ATCTCGACTACTAATGTCAGTGTGGAGGAGCATTTTAGTGACTCGTACTACCAAGCGCGGGCGCTTTTCCGATCACGAGCCGAGGTCGCCGGCGCCAAGC
TCTTCTCTCTGCCCCTTGAGCATCTAAAGCCGCTGGATTTGACTGTGGATGTGGCAGTGATCGAAGGCTCAAGAGAACGCGCTTTACTACATATTTCAGC
CACGCACGGCGTCGAAGGTTTCGCGGGGAGCGCTATCCAAGCGGCGCTGCTGGAGCGCACGGCGACACCCCCAAGCTCCATCAAGAACAAACCCACGGTG
ATCTTCGTGCACGCATTAAATGCGTATGGATTCGCGCAGCTGCGTCGATTCAATGAGCATGGTGTGGATTTGAACCGTAATTGGCTCACGCCAGAAGAGT
TCACGGAGCGCCAAAAGAGAGACCCAAACCGATTGGGATACATGGACGTTTACGAGCTGCTGAACCCGATGGAATTAAGCGGGGTCAAGAACTGGTTTTG
GGTAAAAGGCATCATGCATTTAGCTACTAAGGGTTTTGATGCGATAAAGCAGGCGACAATTGGCGGGAATTACCACTTCCCACAGACGCTTTTCTTCGGT
GGAACGGAGCTTGAGCCGAGTTTGGTACTGCTGCAGAATTTCCTAAGGGAACATGTCGACTTCAACGCCGTAACCAAGTTCGCGATGGTTGATGTGCACA
CGGGGCTTGGGCCTGCCGGTGTTGACACACTGATGCTAGGAGCGGGGAGTGACATGGAGACAGCACGCATCGTCTTCTCCGGCTCGGAGTACACGAACAA
GGTGGTCTTCGTGCACGATAATGATAATCCGGTGTCACGCGGTTATGATGGTGTCGGCGGCTTTACTTTCGATGGTGTTGCAAAACTGTTGGGCCCTCAA
TTGGAGAAGAACGCGCTTCTTTTTTGCCAAGAGCTCGGTACGGTGCCTGGTGTGTTCATCCTGAAAGCAATGGTCGAGGAGAACGCCATCTACCATCACG
GATCATCATCTGCAAACCGCTTGCCGTACGCGCAGAAACTTCGGGACGTGTTTTATCTACACCAGAGCAGCTCTTGGAAGAGTGACGTACTGCGTCGCGG
CGCTGACGTATACGATCGCTTGTACGTATATTTGTCCTCGTAGCCTCAAAGAATGCCCGCGCTGTCCCTTGTATACTGTATCTGGGTGCTGTCGTCACCC
CAGAGCAAGGCATTCGAAAGCAGGTTTATAAAAGCCAAAACGTATGACATGCGGTAGTAGATTTTAAGATAGACCTGTTGGTCGGTTTCCAACTTCGACT
TCATGTAGCATGTACCATACTACCGTACTACCAAGCTCACGATTGTTGTGCCCGCATCAATCGACATTAGGACATGTCAAGCAAGTGATCACATGTCAAT
CTGCTAATTCGCATTGCTCGGTTCATTTCTTCGGACTGCGCACTTAACATATTTCAGTAGTTGTGTAAACCACTTCACACAAACGTTATCTCATTGGCTG
AAAACCGCTTTGATTGAATGACTGGCTGTTGGGCAGCTCATGACGGCCACGAGCCAAGTCGCCCCCATTCGTTTATTCGCCATCTACGATCACCATGCCC
ACCAAGAAGGTCAAGCGCACCACCACCACCACCACCACGACCAAGATCACCAAGGGTGTCAAGGTCTCGGCTGCCTCGAAGAAGGACCCCCTCTTCGTGG
CTACCCCGAAGAACTTCCGCAAGGGCGGTGACATTCAGGTATTTTGAAGCGCCGTTTTTCCATCCTATCGTTTTGTCCTTTTGTCTCTCGATGAGGGACT
AAAGGCAGCGATCCACGTCCCTCTGTGATGATAGAGAGGAGTGGTTGAGCCTCTAGCTTAAGTGCTGCATGACTCGACCGCTGTCTCTCCGTCTCGCATG
AGAACAGTGTAGCGGGTCCCCCACGACCGCAATGACACAAAACTTGTGGTGGCAATTTCATTCGCTAGCGATGATTTGCGCCTCAAGGGTAAAGAACCTC
TCTCTCTCTGCCCTGTTGTCACTCGTGGAGGAGCGTGGTTGCCTCCTCATGCAGCAGCTTAACTAACTCTCTGTTATTGTCTTGCTCTATCCCTCAACAG
CCCAAGCGTGACCTGTCCCGCTTCGTGCGCTGGCCGCGTTACGTGCGTCTTCAGCGTCAGCGCAAGGTCCTGTACCAGCGCCTGAAGGTGCCGCCGTCGA
TCAACCAGTTCTCCAACACTGTGGAGAAGAACGTGGCCACGGACCTGTTCAAGCTGCTGCTTAAGTACCAGCCGGAGACCAAGGCCGCCAAGACCCAGCG
TCTTCGCAACATCGCTGCCGGAAAGGAGGAGGCTTCGGCCCCTCCCGCCGTCGTGAAGTTCGGTCTTAACCACGTGACCTCGCTGATCGAGAACAAGAAG
GCCAAGCTCGTGGTAATTGCCCACGACGTTGACCCCATTGAGCTCGTGGTGTTCCTGCCCGCTCTGTGCCGTCAGTTCGACATCCCGTACTGCATCGTCA
AGGGCAAGGCTCGTCTTGGCCAGCTCGTGCACCAGAAGAACGCCGCTGTGGTCGCTCTGACCCACGTCAACAAGGAGGACAAGGCTAAGTTCGACTCGCT
GACCCAGGTGTTCCGCACCAAGTTCAACGACGACTCTGTGGCTCGTCGCAAATGGGGCGGAGGTATCATGGGCCTGAAGACCCAGAAGAAGCTGGAGCTG
CGCGAGAAGGTGATCGCCGCCGAGGCTGCCAAGAAGGCCCAGTACTAAGATATGTACCGGGTTTGAAGTGAAGTGCGGCGTGGCACGCTGCATCTTGTCT
TCTTTATTCGTAGGTGCTCTCGACAGGGAGGAAGTCCTTCCTGGCAAGTGTAATGGCTGAATAACATTTAAACTTCCAACATCTCTACGTTTACATGCAC
GATTTCGTTATGCCCACCTTGGCAGTAAGTGGCTCGTCGTGAACATAACTCCACGTGGATAGACGTGTACTACTTGTATCCATAGCATAGATGCAAGATA
CTACGTCAAGGCTTCTCGCAATGAAGTTCAAAGTATTAACGGCTCCATCTCACACTTTCACTTGATGTTTGTAGGGTAATCATATCAGCTAATCGTTTGA
AACTGCTACAGTAGAGAAAAAGCGTCTCCATTTTCGTCCGACCTTCAGCGTTTCAGTGTCAAAAGTGCAAAACAGAGCACACGCGCACTTCTTCTCTTTA
TCATGGGTGCGTACTGGCACTCATCTCTTTTGTCTACCTTCTCTCCACTCACCCATTAATCTTTCCATACATTTGTGCTCTCATTTGGCCGCTCTCCATT
AAAAGAAGACGCGGAGGATATCACGGTGAAGACGTCGTCTGAAGATAAGATGGTCCAGAGCACCCCCAGCAGCACGGGCACGGCATCTGAAGCCTCTCCT
GAACATAGCAATGCCAGTCCAACAGCCAAGAGTGACGAAGGCTCCGTGATGCCACCTTATCAGGCGCAAGCTGAGGGAACGTACTCGACAGACCTCTTTC
GAGCCTTCCCCAAAGTCTGTCAGAAGGCAAAAAGTGGCGTGCAACTCTGCCAGGCCGTTTCAGCATTCGTCACAGAGCGAGCTGGATTGGAGAGTAACTA
TGCACAGTCACTGCTCAAGTTAGCACAGTAAGAAGGGTGTTCTGCTTTGAGCTATTATAGAACATATTGACCTTTGTTGATGCACTTGTGCAGGAGTGCA
AAGGCTGAAGACTGGTCGGAGCAGTTTACGGGATGCTGGACCATGTTTCAAGAAGCCACTGAGCATTTAACTCAAGAGCGGTGGGCATTTGCCCAGATAA
TGCAGAGTTCTATTGTGCCTGGTGCAAAAGCCTTCGCACAACAGCAGGAAACTCAGGTGCATCGCCTCATTACAGGTTAGTCGCGTTGCCCTTGCATTAT
TTACCTGTCGTTTGCTGGATGCCGTAAGGACTTTAACGCAGATGATTCTTGTAACTTTTTTGCAGAGGGGACAAAGGTGCGCTGGGCTCAACAGCAAATG
ATTTCTTCCATGGACAAAGCGAAAGAGAAGTACGAGCGGAAATGCCAAGAAGCGATCGAGATCACGACAGCAATGAAAAAGAGTGACAGCACACTAGCAG
ACGTCCATTCGTCATCCTCTGAGTCGTCGTCCGAAGAAGTTTTAACGCCAAAGGAGCTGACCGACAAATTGGCAGCAGGTGCTGGCCAACTGCTGACGAA
GATGTGGGATACCACGTCTTCTTTTGGGCGCAACCCCTTGGAGCGACAGAGGTCGAGGCTATATAGCAGTCTTGAAGATGTTATCGCCGCGGAAAAGCAC
TACGTCCAGACGGTGGAGTACACAAACGCTCAACGTCCCATTTTCGAGCGTGAAATCAAGGAAAACTTGCATGCGTTTCAACTAACAGAAGAACAGCGTC
TCGAGTATCTTCGAGACGTGTTGATGCGCATGCAGAAGGCTTTCATCGCCATGTTTTCGCGATCTCAACAGTTCGTCGAGCGGATGAAAGCAAGCGCCAA
CAAAGTCGATGAACTGGGTAAGATAAACATATCACCACGTGACGAAATGGAACTTTACTGACACGTTGTGGCCGATTTCTAGCTGATATTGAGAAGGCGT
TCCAAAGCCTTGGAAGCCAAGACGAGATAGATGTCGATCGAGCAGACGTATCGGCCAATCCTTCCTATCTGCGCATGACGCATATCCAGGAGATGTCAGA
CACCGGACATCGGATGGTTGGAATAATCAGCTCAGTCGTGACAGAGTTCATTGCGACCGAGACCCGCTTTTCACATTATCTACGCAAGCTTCTGCGAACA
CATGAAAATGGTGGTCACGTTACGCCAACAGATATCTTCGGTACTTTATCCAACGCAACGAGCTTCCTGTCCGATGAAGGCGCATCGATGGCGAATGGCT
GGATGGCGGTGAAGGATCAAGTTAAGCTTCTTCTAGAAGTTCACCAGGTACGCTGCAAGACCGGCATCGTCTCCTTCGTTATTTTAATGATTGTTGTCAC
TGTGCAGGAATTCCGATCGCTACTCGCCGAGCCCGTGTCTCTTAGCCTTGCCACCATGAAGAGTGAGTACGAGAATGTTCGAGTCTCAACGCAGGAGAGC
TTTTCGAAGTTGCATACGTCATTGTGCTATGAAGCAGCAGCTCACAAAAAGCTTCATCAGAAGCTTGACACGAAAGCCCGGGAATTCGCCATGACCTTTT
CGTATTTGCCAGGAGCAACCCCCGTCGCTACGAATTCCTACGGCATTGATATCACGCAGGCTCTGGAGGTACTGAGTGCCAATGTACGCTCGTTCAACGA
AAAGGAGCGCCGCTCGGAGGCCAAGCTCCGTCAGCTTGCGGAGGAAATACGCCAATTGCAAGCGCAAGTCACCGATAACACCAAATCGTTGAAGCAGACG
TACCAGAATTACGTTCAGGTTCGTCTCCATAGTGACTTTTTCCTTGTGATAATTTCTAACGCGCTGACCAAACTTTGCAGGAGATCGAAGTTTTTATTTC
AACATGCATGAAGAACGAGAAATACCGTCTTCAAGTCGGCAAGAACTCGCTGCAATCACTAGCGAAAGCCATCGAGCATATGCTGCAAGGTGGGACTTCA
GTCGGAAACAAAGCCCTGATAGAGTTTGAGAAGATTGATCCCAGCACAGATATGACCGAGTTCATTCGAGTCAACCAACAGCCGTACGAACAAATCCAGC
GCATCGTTCCTGCTTATCACGGCAACGATAGCTTAAAAGAAGCGATGCGAGAATACCTTTCGTCGCTTGGTGCGTCGTCGTTGAGCTCAGAAAATGTAGA
CACCAGCTCTCGAAGCCGTACAAGTAGCATCAGCGCGTCTATTGCAAGTCTCAGAAGCGAAACAAATGCTTCGTCCGAGAAGAAATCCCCGCGTCCGAGT
GTTATCCACGAACGAGACAATAACACAGCGACAACAAACGACGCCAATGCAGATGGCAATCTTTCGGAAGAGGATGAAAGTGAAGAATCTGGAACGGAGC
AAGAGGAAGATTACGCCGAATCGCAGCCGCTAGGCGTTTCCGACTTCCAAAAGAAGTTCAAGGTAAATATGGTGCCAACTGTAAAAGGGTGTCTTGCCTA
CTAACAGTTATTTCTTGCTTGTCGTAGCTGGACGTACCCGAACAAGTTGTCGAAAGCTATTCGTGCGCACTTTACCTGTCCAACTTCCCATACCATGGAC
GACTTTATTTAACCAGAGACAGCATGTGCTTCTCGGGGTGGATTGACACTGTATTCGTACGTTATCTACCACGTGAAATGTGATATTGGTGGACAAAATG
ATCTGACATGTCGCATTGTAGGTTGCATCATTGTCAGACATTTCAGCAATGGAGAAGAAGAACACAGCGCTGATAGTTCCAAACGCTATTGAGGTTAGAG
TCATCCTACTATTATCTGCTTGCTTGCACATGCTCATACCGTGTTCCTTGTGGCTTATAGTTCACAGTGAAAGGAGAGAAGGTGTTCTTCGCTTCATTTG
TTTATCGGTAAGTATTTCATCCATTTTTACCTAAACGCGCTGCAGCATGATGACCTTCCTGTCCATGTGAATTACAGCGATGAATGCTATCAGAGTATCC
AGCAATTGCGATCCATAAAGAAGGAAACTGAAGAGCTTATGTCAGATCCAGCAAAGCAACCCGATACTGAGTTTCTTGACACAGACAACAAGCCTGTGAC
TAACGGCGAGTCAAGACGGCGTAGGAGCTCCAAAGACTTAGCTGCTGTTGCTCCTAGTCCTGATTCGACCTCCACTGATACAACTCCTACAGAGGACAGC
CGATCCCCGTCTTCCCCATCTTCAGATTCTGTGTCAACACCTCCCACAGTTCCAGACAAGGATACACTTCTGAGTGAGTACGACATGCTGATGGACGAAG
AAGTAGAATTCAGGTACGAAAATTGATGGAGCTTCTGTGGATCTCACTGGCATGTGCACTTGCTAACTGACCTGATCTTTGCTATGCTTGCAGCATTGCG
ACTGCTTACGCAACGTTATGGGTCGAGTCGGACACTTTCTCGCGTAATGTTCTTGAGGCAGCCGGCGCAACGAAAATCTCTCTCCCTGCATGGGAGAAGA
AATCTACCTCGTACACTGCAGTGACCTCACCCGACACGTTTGATGGCTCTCGGGTGGTCTCATACACCCACAACAAAAAGTATATGGTCGGTCCCAGTGT
CATTCCTACGACGCAAACCCAGCGCTATGCGTACAAACCAAATAGTCGCCTTGTTGTGAGTACGACGACGTGCGTTTCCGATGTGCCGTACTGCGATTAC
TTTCGCGTTGAACATCGGTGGGTCTTCAGTGCTACGAAAAAACGAGGCGTGTGTTTGGCTCAAGTGGGGCTTCGCGTGCAATGGATGAAGAGCACGTGGC
TGAAGAAGCAGGTAGGCAAGCGGGTTCAAGGATGTTTTCATCATACTCCGAGTGCGTGACTGACTTTTGTATCGTTGCCATGTCACCATAAGATTGAAAG
CACAACTGTCACTGAGGCCAAGGATGCTATTAAATCATGGCTCAACGCTGCTCACGATACAATCAAGGAGAATTCATCAACGAGTAGCAGTGCTGGCCCT
CCTCCACCCGCCAGTAAAGCTTCGGCAATGCCATCGGAGTCTGAAAGCAAGCAGGATGCTTTATCCACGAAGCCTAGTGATGAGTCTGCAGCCGTAACAA
AGGCCTCTCCAAATGCGCCAACTTCCACTACGATTAATGGACTGCTGACACGACTTCACCCAACAATTCAAGTGGCAATCGCTGTCTGCGCACTGATGTT
CTTCTACACGATGTATCGAGTGTGTGCTGCGATAGACCATATGCAAGCATTGACAAGGGAGTCGCTGATCCAGCAGCGTCAGCAACACGAGTTACTGAAG
GAGCTTTTAGAGATGCTTGGACGAACGAGAGAGTGATAATCTTTGACTCGAAAGCTATGAACGAAGAAATAACTGGTATTATAGTCTCATCTTTATTGAG
TACATACTTCTTCATCTTCGTCCTACGCATTCACAAGTCAGAAAAAGGTTAAGACACTTCACGATCGAAGAATAATGATTCGTACGTCATCGCTGTATGG
AGGGAGAGTGTCGAAACTTAACTTCGGAACTCCTTGAGGTCGCGAGTGGTGTTGATTCACATCTTCGACGGGAAAAAGCAGAATGTCGTCTAGATTGTCT
GATAGAAATGCTCTGTTAGATATCTCTGAACAGTATCGAAAGCAATTAGTTGCTGAAGCTCTACCTTCTTGGTGCTGATCATCCTCTGACCAGCACTCAG
TGCTCCACGTTTCACGAATACTATTTTGACTACTTTGATTGCTATGACCAGTAGACCCCCCGGTCTTTGCTTGTCTTAGAGCAGCTTGTAAGCTTCCGAG
TTCGTGCTGCATGCTGTTCACTCGCTTCTTCATCACAGTATTTTCCTGTTTTATAAGAGCGAACTCTGCTTGCAAGACAAGGAAAAACTTGAGACCCAGA
GAAGACGGCGACCGTAAGAACATATTTCCACGTACCAAAGATGTCTTGCTCACATGCACACCAAGTCTTCGCTCCTTTGCCGTTAGTTGATTTGATAGGA
CTCTTTCGGCTCGTCATGTCAACATACGTGCTAAACTCGTCTCGAATTCGTGACAAAAGACGACCGTAGTGCTGCAGCAGAAGGAATTTAATACGTCAAA
GATTGCTGAAATATAAACAATTGCATGTAAAGCGTACCTCATCTTGTAGCACAATGTTGTCGAGCACGCTTTGGCACGCTCGCGTACGTGATAGGGTTTT
CTCTGGTAGCTATAAGAGAGCATGAGCTAAGCACCATAAACTCAAGATCACCAATACGTACGTTCGAACGTCCTATCTCGTTCAACCGTTCCACAAGTTC
GACTTCGAGTTGCACGGACGAAGATCTGTATCCACCTACGAGAACTGATGGTGTTGGATGAGGTGCGTTGGAGCTAGCAACGGATTGAGCCGGGTTGGCC
ATTAAAATGGAGGCGCTGGCTGATCGATTGGGACCAATACTCACTCCAGAGATGCATTCATCCTGGTTTTGCGGCTTTCGTGTGGGTACCTGTAGTCCTG
AATTTTTCCGAGCAAGACTTACAATGCCTTGGCATGTCGATGATGCATCGGCATCGGCAGCAAAATTTTCCTTTACGGGTTTCGTGTGGGTTTTACATAA
AGGCGCGGACGTCAAGTTTCGTAGTGCTTCAATTTGAGTCTGCAACTTGTGGTTTTGACGTTGCTGTCCGCTGTGTTCCACCGCGTGAAAAAGTTTCTTC
CGGACTGCAGACGCTGAAGCGGATCGCCTGCTTTTCAGACACGAATTGGGATCATCAAGCAGGTTAATAATCCACAAAAGTGTTGGCTTACCGAAGCATT
TGCCGCGTATTTGACGGTGCTAGCACTGTGGGTTCGTTCGCAGTCGTCGCTACAGGCTTCGCTTTAGCAGTCGTCTTAGTGATCCCTGAGGATCGTATAA
TCGACGATGTACTGCGAAGATACCCTGGATGAGTCCCGTATCTTGACGCCAGCTCACGGTCAATCTCAACACGAAGGTCCGAGAAGGAGTCTTTCTTGGA
GAACTGTGGTCGAACAAGTATGCAGCACATATGAGCAAATTTGGTACTAATAGTTTGAGGTGCTAGTATCATACTTTGCCAAAGAAGCCATTGCGCGGTT
CACCATTCTCTTGACTTGCAGTGTTCCCCGAAAACAAGGGACGGTAATGCTTAAAGTATAGTAAAGGTGAGCGAATTACTATCACTTCTGTTACTCTGAT
CCCCACGTACCGACACGGCAGGTCCAGTATTGTACACACTGCTGCGTTTGCGCTGCATGATACTTGAGCTTCCTCCTTCGTTCGAAGGCGCAATACGTTT
TTGTTCAGCCTAACAATAACTCTATTGAAATTGGATTGATATGTAAGCCGCCAAATTTGGCAGAACACGTCTATAGAACATTGGGAACCAAGCATTCCAG
CAGCTCATGCTTTACTCGTCGTCGCTGTCTTCTTCTTCCTCCTCGTCAAAGTGGCCCTTGCGGCGATTCCGGTTCACGTGCATCATGGCAAAACGGTCCT
CGGCCATCGTCAGTCCCTTTGACGAGGAGCCAGCAGACGGTTGAGCGTTTTCACCACCCACGTCGTCGTTTTCCCCGCCCTTCTGTTCTTCATCATCGTT
AACATTGTCTCCCTGCGTCCACGCCGGTCCCGTGGGGGAGTCATCAAACGTTGCAGGCCTAGCGGTAAGAAATATGCACGTCAGTGCCATCATCGCCAAT
GCACACTTAACCGGGACTACTATTGCTTCTCATGCTGCACCGTACCAGAGTTCTTTGCGTTTGAGATTTTTGATCTGCTCTTTGTACAAAATGTGCTCCA
CGATGGAAGTCACGGCACCTTTCTTGCCTGTTGCAGTCGTGGTCTCACCACCATCACCTTCACCGACAATCAAAAAGTCACCTCGCTTGACCCAAATGAG
CTTGCGGAACTTGGTCGGCAACATCGTCACAGATTTTGCGCCATTGGCGTCCTCCACCTGCCAATTAAACAGTGTAAGGTTAGTATCACCATTACCGTTG
ACCCCACTGTACACATTGTAATTGCACCTCGAACAAGTTGCTGCCTCGCAGTGCGGTAACGCGCACGATAAGCTCGTTCTCCTTGGGTTCTGGGTCACCG
TACAGCACGCGCTTAGTGACGCCCTTACGGTACGCGCTCTTTCGTCCACTTCCCGACATGTCAAAAACTTTATTCAAGTTTTGCAACTCACAGTCAACAC
ATCATAATTTAGTCGGACTATAAAAAGGAATGGACCAGACGATCTGTAGCCAAGTGCACAAAACTGGCATCACTTCCGAATTAACGATGGCTGGACGAGG
ACGCGGACGTGCCAACACGCTGCCGGCGTGGATGACTAAGCAGGGACTTAACGAGCCGCCTGCTGGGCCTGCACCCGACTCGCGTCCACCCCCGTCGACT
GAAGGCCCTCCACCGCGCAAAGGCCAGTTCGATGATGCGCCCGAGCCGAATCGCGGGCCAATGACACCCAACAACATGGGCATGCCGTCAGGCGGTAAGC
GGCGCTCGCGCTCTCGGGATCGCGGAAATGGGCCTAACGGTGATATGAGAGGGCCGCCACCCAGGCCAGACCGACCCAGGTCGCGCTCTCAAGATCGCAG
AAACGGCGCCAACGGCGACATGAGAGGACCACCACCCAGGCAAGACCGACCGAGGTCGCGTTCTCAAGAGCGCGGAAATGCCCCCAACGGCAACATGAGA
GGGCCACCGCCCAGGCAAGAGCGACCCAAGTCGCGCTCTCGTGACCGAGGTAACGGACGAGGCCGAGGCCATGGCTTTGATTCGGACCGTCGTCAAGAAG
ACTCGTTCCGACGCGGACCGCCCCGTGGACGCTCTCGCTCGCGATCTCGTGAACGTCAGGACAATCGTGGAGACTACCGGCGTGGAGGAGATCGCTATGA
AGACCGTGGATACGGTTATCGCGGACCTAGAGATAACGGACGGCCGATGCGCAGGGAGGAAGAAGCAACGGAGCGCGGCTACCGACGCCCTGCACCTAAT
GGACACGATGATCGTACGTCCCGCAGATACGCGTCGGACTACCAGCCGTAGACGTAAACCTCCCATGTTTTTTCAAGGTTTGAAGATTCAAGTTTTTAAA
AACAAATGCACGAAAAGTATTTGAGATCGAAGTTGCACTGTTTGCAACTTAAGAAATGAAGGGTGGGGTATAATAATAGCAGGCGGGTGATGCAACGCTT
CGATGGTCGAAATCGCGAGTAAAAATAAAATGGTCAGTCTAAAATTGGAGTGTGGTTGAGTTGCAATATTGCACTTTGGAAATTACTGCACTTTTGAGTT
ACGAACTACTTGAAGATGGCGAGTGAACACAGCTCTGCTGTCGTGTCGTTGCCTGGTTTAATACCGACCACCATGTCGCCGACTGGAACAGCTAGTGAAA
CTGTGACGGGGCAGGAGGATGCTGCTGTCAAGAAAACTGAAGCACTGTCGAACTCGAAGCCACGTGAGCCAAAGTTGCTTTTCGCTGTAGCGAAGAATGT
TGTGACAGCGTCCAACGCTGCGCGGTCGAAGAAACAGTCCCCAACTAGTATCAAAAGCCCCGAGGCCGCAACGGGAGAAGCAACTGGGAGCAAGCGAACC
ATGTTTGGGATCATCAAGCGAGCTCAGACGAGTGAAGCTCAACTGCAGCAACAGCAACAATCATCGGAAGAGAATCGACAGCAAACAAGCAATCGAGAAT
CAAAATCTGAACAGGATTTGAAACAATCTTCTTTGTCGATCGAGACTGAGGACCACACCAGGTCGGATATCAGCTTCGTAGATGTCGTGCGAGAAATTTT
GGAGAAACTGGTGACACAACTGGACAGTGTCGATCCCCGCA