Description :
From Genome Similarity Track
Location :
Scaffold_8:190200- 194181
Sequence
3981 bases(100 bases per row)
AGCTGGATTATCGGCTGTCGATGTGCAGCCTCTAGTCACCCAGAAAGACATAGCAGCAGGCGAGGGCCCTGTCCACGTGCTGCTGGTGGTGGCTTCCCAG
CATGAGCTCAAGGAAATACCGACGACGCCTAGGCCTTTGCAAGTCGACTGAGGTGTATCCTTTTTTTCGGTGAGGTCGATAATCTTCTTAGTCGAGTGAT
TACACTGCTCGAATCTTATGTCGATGAAAAGGGGATCGGGTACACCGCCTTTCAACGCATTCTTATTTTCAGACGGCAGCTAGAGCATCTGCATCAGTGG
AGCTATTACATTCTATTTGTTGGAGGTGAATCATATGTTATATTATGTTTAGCGACCGAGTAGCCGTTGTTTCTACAGCAGTAGCGCAATTCTGCTGTCA
ATTCAGTAGCTAAGTAATGGGCACACACGCTAGAGATGGAGCAAAGTGGATGTAAGATCTCCTTGATGAAGCAAGTGGCGAAATAGATGCATTCATGATC
ATTACTTCCGCGGGAATCCACGACACCATCACCACCAGACGGATCAAGGTCCGGACGAAAACCTAAAAATCTTCAGCAATACTTGGGACCCATATGAGAC
TACATCCTGCTCTCGTAGGATTTATTCGAAGAATTGTTTTACCTTGCTGTAGACCGCATCAAAGTTTTTCATTTATTCCCTCGCCGCCGTCCCCACTTAT
CTCACCCACACCTCACTCAGCGCCTTATATTCTGCAGTGCGATAGCGATAAATATCAATCCGCCCTTCATCTTTGTAAATCCATATGTGCAGCACATATC
CATCGGTTACGTTGTGGCTGCTATTTCGCTCGACAAATTTGGCTCCCAAAGTATTCCCCACAGCTCTTATTCTACTAGTAGCGTGCATGTGGCGTGACTG
GTGGTTCCTCCAATAGCCATTCTATAGCTAAATATGGCATTTGTCGGCTGGATAGCCGTGTGAGGTTGTCGTACACAATAGCTGAATGTTGGCACCTCAT
GCTAGCTTCATAAGCGGCTGGGTAGCCGCAATGATGTAAGGCTAAGCTTGCAGGTTGTATGCTAGTGGCTGAACCAAGCCACGTACATGTGTAGCTAAGG
AGAACAAGTGGTTGACGTTGAAGCTGGAGTACTAAAAGACTAAGGACAAGTACAAGGAGACCAGTCAGGACAGTAATGTCTTTAGCAACCACAATTCCAC
TCAGCTGACAATTTTCCCTCTATTACAACTATTATAACGTGACAAGCCGTACCAGTGTAGATTCTGTTGGTGGGTTTAATGTAGAGATGCTCAAATCAGG
AGCCATCGCTGCTGTGGATTGCTAGAGTGTCGGGGACAGAAAAACCATGCACACCTCTCGCTTTCGCATTTCATATGAGGCAACGAATTGGGATTTGACC
TGGATACACTATTCTCAATCTATTAAGGCGTCTATTTGTGACCGGCAACGGGATCATGGTAGCGGACTTGCATCATCGAGCATAATGGGATAGAATTGCA
GAAACATATATTATATTCGGCATCTCGAAAAAAACTAGTTTTCTGGATGCTCGAGATCGTACGTGGAAGAAGCGCGCATCATATGCAAATGATAGCACAT
GCATCGGCGTGAGAAAGGGACCCACATACTAATTTATATGAGCTCGTTGTGTGGAGCTTACAAAAACATTCAAATTCCTTTTTCTCTGTTCATCGACAAA
ACAAAGCAAAACGTCTTTATGGGCAGCCAAGATGAGGAAACGGAAGACATATTAAAGGAGCGGCTAAACTTTATAGTGGTTCAAGTCGTGGCGTGGTCGA
AGTATGAGCTTGAGTTATGGAGACTTATACAGTGCAAAGTATAAATCAGGGAAAAGGTTTTTTCGTTATGTACGAAGCGGGTTTTATGGAGTCCAGAAGG
CATTGCATTTCCGACAGACGATGAAAATGAACAAATGTTGAAGACCAAATTTTCCGATTTCGTGGCCGGTGGAATTGCAGGGCTCATGTTTGATCTCTTG
ACAGAATATATTGTCAGAGCTTAGGACGGAGCGATCGAGGAGGTGTCGAACCTTGCCATATTTTCTGAAGGACTAGTCCGTATTTCTTCGGACACGGTTA
TCAATCGTTTGATGTCTTGATTTCATACAGCCGAACGTCGTTTTGACACGTACTTCGTAAGTCAGTACGTCGGAAGAGTTGTCGCCGTGATGAAGGGCCC
ATCCGGACTGCAGAGGCTGGCAAACATATGCTGCATGAATCCGTCCATGGATACTATCCGTTTTACTACCTCGAATTGGGAGGGATTAAAAGCTTTTCTC
TGGATATTATATCCAGGGTTATAGGAGACGAGTCATTCTGGCCTCGAAATTCTCTAACTTCTTATGCTCAGATCCCAAGCTAAAGTTTTCAACACAAAAC
CTAGATAAATTTACTTCAGCAATTGATACGCCTGTTACGTAAGATCTACATTGGATTGTCGTACCCCAAAATAGTGGGTTTTCTTCTCTAAGCGTGCATA
ACCTGTCATTTCAGCTTGTATTATAAACGTCGTTTTACTTAAATAAAAGAATGGTATTGTATAAATGAATATTATCTGTACCAAAGATGTCACCAAGGTG
AATTTAGCTTGTGTCGGCAAGAGGTAACATCACTGTAAATTACAAATATCCGAAGTTATTTTTATTCGCGTGAATGTTTCACGCAGATGATGCGTACAAC
ATTCCATACCGCCAATGTATCTCTTGTGATCGCGTATTTACTACGGTATACGGGACTGTAGTAAAATTGTACAGTATTGCGCGTCAATGGGGAAGCATGG
GAGCTGATATCCTTGTAAACATTATATAGATTAATTTTACAAATACATGCACTTAGGTATACCAGTAATGTAAAGTTTAGCAATAAGGAACGCATGGGGT
CTAATATTCTTGTAAAGTTGTATAGATCAAATTGAAACGTTATTTTCTGGCACTTTGAGTATGCTAAGCTCCTTACTGACACTGTACAATGTAAAACCAA
TGGTGAAGCAACCACCCTACATACAGTAGTGTAATCCAGAGCTTCTCCGTGAAACACGGCTTTGTGCTCTGATCCAAGCAAAGTTTCGATCGATAAATCG
CTTGATAGGCCGGTGTGGCTGTCTCCAGTAAAGTTGAATCAAGCTGGCTACGACGCCATTTTTGTCAATAGAGAAGACAAGTTCGTTTGCTTCGTCCAGG
TAACGCGCACTGAGAATCATAGCTTCGATTCGAAGTGCTTTATCCAGCTGCTAGACAAGCTAGCAGCTGACCGCGATCTTGCTAGTATCGTTAGAGCTGT
ACTTTGTCGTCGCGATGGGAAATTTTCACTGCGCCAATTAGTCCAAAAACAATTCAAAGGACCGTCGTCCAGCACACATCGTCTACACCTTGTCCAGCTA
TGAATACTGACGGGCAGGCCTTTCGATAATATAACTGCAATGAGACCCTTGCTTTTAGCGAAGTCAGTACTTGCAGGGAAACATTTGATATCGACAAATA
CGTAACCGTTACGATAAGAACAATATCACACCACTACTTCCAAGATACATCTCATTTGGATGCATTAACGACACCAGCGACGGTTTTCACATTCCAAAGG
TGGCGGTTTACCTTAATAAACAAAATAAGCTCGATATGGATAGGGAGCAGTCCTTGGCGATGGTTTCCCATGACATTTTGGTTTGACTAAAAACGCGCTC
GCACATGGTGGACGTCGGCGGGATGACTGCAATTTCTGGGTACTCACAGGCCGTCTCACGTTGTAGCTTGCGCTTCGAGAGCGCTTGGTCCGCAAACCAA
AGCTTCTTGTCCTCCGACAATTGGGGCGTCGCAGCGTGAGATGTAAACGGTAGGAGCAGCGAGCGCTGAGCCTCCGTGATATTATCCGCCTTTCCGGGTA
GCACGGTGACACAGGCATCCTCGAACTCAGGTTGCTGGACGATACCAGCGTCTGACCCAGGTACCCCTCGACACCAGGGTG