Description :
From Genome Similarity Track
Location :
Scaffold_31:1902- 3951
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_31-fgenesh-gene-0.1Voltage-gated Ion Channel (VIC) Superfamily

Sequence
2049 bases(100 bases per row)
CCAGCAATGAGCGCTTCACGCAGGGCTGGGAGAAGGAGTACGTCGAAGGCCTTGCACTCGAGGTCTACGCCACCGCGCTGCCGCCGGCGCTCTTCGGACT
CTCGTTCAGCCAGGCGTGTGATATTTTGTATCGCATCTCGAACGGCGAGATCATCCTGCTCGGCGTCTACGAGCGGGGCAAGCACGCGCGCACAACCCCG
GCTGATCCACCAACATCTTCTTCAACACCAGTAGGTGGGACGTCAGCTTCAGCATCCCAGCCAACAGCTGCAAGGCGAGGCAGTGGTAGAAACACCAACA
ACAAGCTGCCAAAGCTCAAAGTGCGTCCGCTGCTGCGGCGCCGCAACTCGCACTTCCGGTCCATGCCCGGCTCGTTGATGCTGATCAACCCGGGGAGCAC
ACTACAGGTCGGCGCGGGACAGATCTTCTACGTCATGAGCGAGAGCAAGAGGCTCACGCAGACGGCGTCAATCGTCGAGTTGCTCAAGGAATGGCAGAGC
GCCGGCAACACGCTACCGGTAGCAAGGGACCAAGTCCGCAAACCGCCACAATCAGCCGCATCAACAATGTCTTCATCACGCCAATCTGCGTCAGCACCAC
CAGTTCCTACTTCACACAACCACGAAGAGATCAACGTAAGACTCGTGAGACGCAGCCAAGAAGACGTCATCATTCAACACGCCAGCAGGATCACCACCAC
AGCAGGCAAAGAGATGAGCAACCACGTGATCGTCGTATCAGACCTCGACCCCGTCTCGATGGAGGCGTTCATCCGCATGCTGCGGCTCGCGTGTCACGTG
CCCGGTGACGAAGACTACCACCCGGTGATCTTCTTGTCGTGGTCCACAAAGAAGAAGAAGAACGTGGCCGTGGTCACGCGCATGCTACAGGAGTACCCAG
ATGCGTTCCTCATGCTCGCGACGAGCGACTCTAAGTCCGAGCTGCTACGCGCCGACATCCTGACCGCCAAGTGCTGCGTACTGTTGGCTGACAAGTCTGC
GATCCAGCAGCTGGACGGTGAAGTGATCGATGGGAAGACCATTTTCCACTACCTGGCGATCCTGAGCATCCAGGAGGAATACGGTGTTGACGTTACGGCC
AAATGCATGCCGCTCGTAGAACTCACAGTCCCGCGTACGATGAAGATTCTGGACATGGAGATGAAGAAGCGCCTACGAACCGCGCTTCAGCGCCAGCAGC
AGATCGACGACCACAACCACAACCTGCTGCAGGTGGTCTCCTCCACGCGAGAAGACCGCGACGACCTCGTCAAGGTCGTGGAGTCTGAGAATGACCGCCA
GCTGCACAAGCGCGGGAGCAGCAAGAACATTGTCAAAAACATCTACCAGCACGGCGCCGACAACATCAGCAGCCTCGAGATCCACCTCAAGATGCAGCAG
CGCGTGCAATACCGGCGCTCGATGATTCGCCGACAGCAGGCGCTGATCGAGAAGGCGTACTTTGAGTCCGGCGGCGCGTCGGTGCTCCCATTCTTCGCGG
CCGGGTACGGCTTCTCCGTCGACATTTTCGACAACATCCTCTGCCAGAGCTTCTTCACGCCTGGGTTAATCCGCTTCATCTACGAACTGTTGTTTTCAGA
CAACGGGCAGTCGGCGACCAAGGACGGAGGCGCTCTGCCTGGGACTGGAGCAGGAGCAGCAAGCGCGTCCGTCCTTGGGACTAGAGGCGAGGACAATGGC
GATACGAAGATCGCAAGCTCGCTTGTTCAGATCCAAGTGCCAAAGGCGTTTGTCGGCAAGACGTTTGGCGAGATGTTCACGCACTTGATCACACAGGAAG
ACATTGTCGCGATCGGGCTCTACCGACTGAGAGGCATCGAGTACCTGCTGCCGTACGTCGCTGCGGGGCCGGCGATGGATACGCTTCTGGTACATGACGA
TATGGTCTTTGTGCTCGCGCAGCCGGCAGCGCTGAGAAGAGAGAAAGAGAGTCGAAGGTGAGGTTGAGACCTACACATACCAACACAGATGAGTCCACAT
ACTAGCACTAGGAACAGCAGCAACCTCAGAGACCTCGTCAGTACCAGTT