Description :
From Genome Similarity Track
Location :
Scaffold_1044:1902- 3360
Sequence
1458 bases(100 bases per row)
TCATGGCGGACGACCTGAAGGCTGCCTTCAATCTCTTCTGCTGTGTCTACGGTGTTGGTACGCTTGGTATGCCCGGCAATTTCTCTCGAGCCGGCCCCGC
GATTGCCGTGATCGCCCTGCTCTTCATGGCCTTCGCCAACGTCTACTCGTCGGTGTGCATGTCGCGCGTCATGCTACTCGCCCCCAAGTCCGTCAAGACC
TTCGGCGACATGGGCGAGTGGTGTATGGGCAAGACAGGCCGCTGGCTCACGGTCGTCTCGCAAATGGGCTCGTGTCTGCTCACGCCGTGCGTGTTCCTCG
TGCTCGGCGGCTCGCTGCTGGATGGCCTCTTCCCCGACGCGTTCAGCCAGTCCGTGTGGATCATCTTCATGGCGCTCATGGTGCTTCCCGTATGTCTGAT
TCCGACGCTGAAGGAAGGCGCCGGCGCAGCCTTCGCTGGCTGCTGCGGCACTGTGATCGCTGACGTTATTGGTGTCGCAGTCGTCATGTACGGCATGCGC
GGCCACCCGTCCGTGATCTTCCCGCACCTGACGTTCAAGCAGGTGACGGGTGCCTTCGGCAACCTGTCGCTCGCGTACGGCGCCGGCATCGTCATCGTCG
ACCTCCAGCGCCAGCACAGCGTACCGACTCGCATGCCGTGGGTGGTGTTCGCGACCGTCACATTCATTTCGTGTCTCTTCTTGACGCTCGCGTCGACTGG
TTACTCGGCGGTCGGGTGCCAGATCTCGGGTAACCTGTTATTCACCATCTATCCGGACTCAGAGACCGGCCTGACGGATCTGGGCTTCAAACCGAGCTGG
GGTGCAGTGGTGCTCGCCTACCTCTTCATGCAGCTCCACATCACGATCGCGTTCTCGGTGCTGTTGAACCCTGCGTTCTACATCTCGGAGCGTCTGGTGC
TCGGCATGCACAAAAAGAAGACGGCAGAGACAGAAGACCTCGAGAACGCGGTCAGCTACCGTGAAGCGTCTACCCCAGCTGTGACCGCAAAGGACCGCTC
GTCCAGGATGTCCTCCAAGATGTCGTACGTGTCGGACGTCAACGGTGAAGACGACGCGCAGCTCGGCGATGCGGAGATTGAGGCGGCCGAGTACCGCGGC
GCAAACGCCATCAAGTACGTGCTGCTCCGTCTCACGATCATCGTCGTGCTTGTCGTCATCTCCATCCTGCTGCGCGACCACTTCTCGGACTTGGGCGACT
TCGTGGGGGCGTCCTGCATCACGGTCAACTGCATTCTGCTGCCCATCGTGTTCTGGTACATCAAGGCGTGGAAGCGAGTCCCCCTGCACGAGAAGATCCC
CGGCGTCGTCGTGCTCGTCGTGTGCTTTGTGTTGGGCTGCTACGTCACGTACACGACCGGCGAGGCGCTGTTCACGCCGACATCGAGCGACATTGAGTTT
CCCTACTGCCCGGAAGAGTACCAGAACACCGTGTACTACAACTACACGGCTGTGCATG