Description :
From Genome Similarity Track
Location :
Scaffold_399:19001- 20871
Sequence
1870 bases(100 bases per row)
ATTCCTCCTGTTCACTTATTCTCCTTTGTGAGCGATTCGATTAACTCAGCGGCTTTCGCCAGAGAAAAAAAGGTCGATTCTTGTGGGGCTTAACGGATTC
TCCGCGCTTTCGAGGTCGGCGTTGCGTCGATTTGGTCCAAATCCGGCAACAAGGCTTCCAGTCGCTTCCGATACTCGAAATCCTTTGCGAGTGGGTTGCG
CTCCAAGTACAGCGTGCGAAGCTTCTTGAGGGGTACCAAATGGTTCGTTTCACTGAACGCTTCCACTTGGTTGTCATTGAGCCACAGGTCCTCGAGCTCC
GTCAGACCCTGAATATCCTCCGGAATGGCCGTGATTCGATTCGCACCAACATCCATCACTGTCAAGTTTTTCTGCACATGCAATAAATAGTGAGCCACAG
TATGCAATAAAAATACCGCAGCGAGAAGTTCGAGACACCAAGCCACTTACCAAATGCGCGACGCCCTCGAGTGCCGTGATGCCGTTGTGGCTCAAGTAAA
GTTCTTCCAACGCCAGCGTGTTCTCAAACCCTTCGATCTTCTCCAGTCGATTACTCTACTCATACATGAATAGTATGCGACCAACAACCATCAGTCAGCA
TTTCCTAAGGAAGAAAAAAAGCAAAAGCGCAGCATCTTACCTGGACGCTGATGATTCGAAGCTTCTTGAGAAAGTCCAAGCCCTGGATCTTCGTGATCTT
GTTTTTACCCAACCAGAGCTGCTCGAGGTTCTCGAGGCCTTCGAGTCCCTCAATATCGCGCAGACGGTTGGCGCCCAGGTCCAGTTTCTTGAGCGTCGTC
AAGTGCGTGAGCCCCGAGATCTTCTTGAGCTTGTTGTTGGCGACGTAGAGCTCTTCCAGCTTGGTCAAGTGGCTCAGATCCGGGATCACGCGGATCTCAT
TGAAGGACAAGTCGAGCACGCGCAAGTTCACGAGCCTATCGAGGCCCGAGATCTTCTGGATCTGGTTGTCGTACAACTCGAGATGCTCCATTTGCACGAG
CGATGCGATGCCGTCCATGGATTTTAGCAGGTTCGAGCGAAGATGCAGACGCTAGTTTGCAAACAACAGGATTAGTAAAGTGAGCACACCATGATGCGCA
ATATATACATATATTCAGCCGCTAGCGCTTCGATAGAACCATACGCTTTGTTGTCCTTTACACATACCTCTAGCTTGGGCATATCTTCCAGTCCGTTGAT
CTCCGTGGCCTTCAGACCTGATGTGCCCACATAGTACACGTCCTATTATCCCACCAGCACACACACACACATACATATAACAGCCAACAACACCATCCAT
CCACACAATGTCATTGAGTGTCTCACTCCACAAAACAGTACAGTGTGCTATTGCGATAGGAAAGAAGCGCACGCACCTCGGCGTCTCGGTCAAACTCGAC
GCATTCGGTGAGTTTGTTGACGACTGGCGGCGCTTCTTCGTGCTCCCCGTCATCGTTGTGGACGTCGCCAGTGGCTCCAGAGGCTGGTACAATCGCTTGC
TGCTGGTTGGTGACCACGCGCGCGGTCTTCGGGGCGCTCGCGGGCGCGTCGCTGCCTGCGCTCATGTTGCTGCTGCTGTTCATTTTGCGCTTCTCTCTTG
ACAAAGTGGGCATACATGTTGCCGTACCTGCCCTAGTTTAACGTGCGAATTGGCACGTAATGTTAGTACAAAGTGATATGTCACTTTGTGATATAGTGTG
GTAGAAATACATTGTACACCAAGTTGGGAAGTGTAGCTCTATGTGAAGAGAGCCATTTTCGCTTGTGTGCTACTGAGAAAAAGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGC