Description :
From Genome Similarity Track
Location :
Scaffold_983:190- 4088
Sequence
3898 bases(100 bases per row)
TTGCTGAAACGATCGACGAACACAAGTACACCCGTGCGCCCGGCTGTATCGGGCGGAAGACCGAAGATGAAGTCCATCGAAATGGAGCGCCAGGCTTCCG
GGGCGACCGGAAGAGGGCGCAATGGGGCCTGAGACGTCGAAGACGGCTTGACTCGCTGGCAAGTTTCACATGTGCGGACCCACTTGCGTACCGACTTGTA
CATGTGCGGCCAATAGAAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGACCGAGATGTCCTCCAGTCGGGGCGTCATGATACTCGTGGATTATGCGC
GCACGTAGATCAGCGTCGTTTGGGACGACGACTCGAGGCCCATCGAACCTGTCGATGCTGTACTTGAGCAGATTGCCGTCCAGTCGATATCGATCGATCT
GATTCCGCGTGGTCTTTGACAGGGCACTTAGCGTGTCACTACTAGGAGCACGCAGGTGCTTCATGATGGCACCGTATATAGGGTCATCATCGTACGCTGT
AGCAATCTCGTCGCCCAGCGGGAGCGTGGGCGTGGTCAACGTCAAGTTGATGCCTGACGACACGCAGACCGCACATTCGTCGTCGTTCTCATCAGCGAGC
TGATGTCCCAGCGCTTCACGGGGATCGTAGTCCGGACGCCGAGACAGCGCGTCGGCGAGGATGTTATTTTTGCCCGGCTTGTAGTGAACAACGAAGTTGT
ACTCGGAGAAGAAGGACAGCCAACGAGCCATCCGTTGCGACAAGTGAGGGCTCTTCATCGCTGTCCGCAGCGATGCGTGATCAGTGTAAACCGCAAATGA
CTGTTCACCGAGCAAGTACACTCTGAATTTGATCAGAGCGTACCGCATTGCCAGGAGCCCCTTGTCGTGGACTGGGTAATTCTTCTCGGCTGGCTTCAGT
TGGCGCGACTGATAGCTGATAACGCGTTCGTGTTCGTCATCATCGAGCTGCATCAGCGCACAGCCGATGGCAAAATCGCTCGCGTCGCAGACGACGTGGA
ATGGCTTTGAGTCATCAGCAAGTTTCAGGATCGGCGCAGACGCCAAGCTCTTCTTCACCGAGTCGAATGCAGCTTGGTGGTCCGACTTCCACTCCCAGAT
CACGTCTTTCTTCAGCAGCGAGGACAGCGGCTTGATCAACCCAGCGTAATTCTTCGTGTACTTGTGCAAGTAATTGGCCATGCCAAGCCACTGACGCAAC
TCAATGGGGCTTGTCGGCGTTGGCCAAGCACAGATAGACGATACCTTCTCGGGATCCGCGCGCACACCGTTCTTGCTCACGTAGCATCCCAACACCGGAA
TCTCCGGTGCGCAGAAGACACATTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTCGCATCACCTGGAAGACTTGTCTCAGGTGTTTCAGATGTACTTCCAC
GGCGCTGAGGTTGCCCTCAGCGCGGCTGTGCACGAAGAGGTCGTCGAAGTAACTCGGCGCGAAGTCTCGAAGCGGGCGAAGCACATGGGAGACCATGCGA
TTGAAGGTGGCAGGCGCGTTCTTGAGACCCTGTGGTATCACGAGCCACTCCCAGAGCATCCCGCTCGGTGTACTTACGGCGATGAGAGGCACATCGGATG
ATCTCATCAGGATCTGTTAGAATCCATCGGTCAGGTCGATGGCGCTGTAGAAGACGCTGCCAGCCATGGAGTCCAGTACCATGTCCTTCCGAGGGATCGG
AGTCTGCGCGGGGATGGTGGCATCATTCAACTTGCTGAATACGTGAACAATACGCCATCCCCCTGTAGCTTTCTTCACACATAACGTTGGACTGGAATAA
GGAGAGGTACTCTCACGCCCTCGAAGAAGTCATCGATCGCTTCCACTTGATCACGAGGAAGTGGCCATTGTCTGGTGACGCAGTACTTCGTACCTGGCGC
GAGGTCGATCTCATGCTGAACCCCACCATCCGCCGGTAGCTCGGCGGGGATCTCATCCGGAAAGACGTCGGCGTACTCGCAGGCTGTGTCGTTACGGGAT
TCGCTGATCTCCCGTAAGGCCTCCCAAGTTTGCGTTTGGAATCGTTCCTCTCGAGCAGACTTAGGTTCAGCACCTAGCGGACGTGAACGTTCACTGTCCG
TTGCGACCGCATTTGCTGACTCATCCACCGAGACTGCCTCGGTGACCAAGCATACTTGCTCGACGTCTCCAGCCTTGAGGTCCCGAAGAAAGTTCTTTTA
GGACAAGCCTGGAAGGCGTGTGATCGCCGCCGCTTCGCGCGGCGAACTCGCAATTGAGAAAGTGCGCTACCGATTCGGGCCTTCTTCCACGTACTCCAGC
GCGCTGACCGATTCCATCGGCGGGCTATCGCTGGTCGTGAGTCTCGACGAGGTTTCAGGCGTCGTCTCTTCGACTTCTTCTTCGACTTCCTCGAGCTTAC
GCTCGAGTCCGACTCACTGCTACTCGACGATGCATCACCCTCCTCTAGGCGCGGGAGACCGTACTCGACCGGGCCCGGGAACACGCGGGAGCCCCTGCTC
AACCGCGGCATCGTTTGACGGGAGCCCAATCTGCTCGACCGCCGAATCGTTCGGCGGGAACCTCTGCTCTACCGCCGTCTCGTTGTGTGGGAGCCCCTGC
TCGACCACTGTCTCGTTTTGTGGGAGCCCCTGCTCGACCATCATCTCGTGTTGTGGGAGCCCCTGCTCGACCACCGTCTTGTACTGTGGGAGCCGCTGCT
CAACCACCTCATCATCTACCTCGCGAAACCGCGAGGGCTCTTCGTCCAACAACGTAGCACAAGCCATGCAGAGAGGGCCATCGCTCGCTCTGTGCACTGC
CTGTGTCGTTGCTGTTTTGTCTACGACTGAGACGTGGGGCCAGTCTCTTGGCGCCACCAAGAGGTGTGTGAAGACCTCGCTCACGTCGAATCCACGTCGA
CGCTTGACTGATTGGGCCAGCCAGTCAATCTCTGGCTGATATCGCGCAATCCAAGGGATGCCCAGGATGCAGTCAAACGCGTAGTTCATCTCGATCACCA
AGACGTCGTCCTTGCTACGGAAGCCGTCGAACGTGTACGACAAAGACACGTCACGCCGCGCAACGCGGCGAGCCTTACCATCGGCGAGTTTGACTTGGAT
CTCGCCCGGACCATTCCGGACGCGGACATTCGTGGGTAGTACCGACAAACACGACGCGCGAAAGAAGTTATTGGTCGCTCCTGAGTCAAGGAGCGCGCGC
AATGGTCGCCGGGCACCGGTGACGTGGAGGCTGACAATGATCAGTCTCGAGTCGCCCGGCGTAGTGGTGGCATTGGTGTGTGCTGGGAGCACGGGAGGGC
TCGAAGGGTTGGGCTGCCACCGGAGGGCCCGGTCCTTCGTTAAAGCCAGTAGGGCGCCCCACACCTACTGGTCCTGGTCGTTTTTTGAATGAGCGACCGA
GGAGTGTTCCGCGTCGACGTGAGAGACGACGAAAGCTGGCACGCGGCACTCCGCTGCGCGATGACCCTTCTTCCCACAGCGGAAGCAAATGAGGGAGCGA
TTGCTTCGCCCAGCGCTGCCGCGGGAGGACCCGCGACGTCGATTGCTCGACGCGTTGATGGCGTCGATCTCCATGGGCTCGGGGGTAGACTCTCAGGCTT
CCGCAGGTATGGCTGCGGCGTACGATGCAGCGACCATGTAATCCTCGCGAATCGCGAGTGCAAACGCCTCCTCGAGAGAGGAGGGATCAGCTCTGGTGAG
GCAGTAGCGGGTCATACCCTCGCGCATGCCGAACACAAATACGTGGACTTGCGAGGCCATGTCGATTGGCTTGGTCACGATGCATGACGCCAGATGTCGC
GTCTTCTGGACGTAATCACGCATGGACATCTGCCCTTGCCGCAGAGCGAAGAACTCTGCGCGAACGCGAGACTCATCTTGCGGAGGCTCGAACGCGAG