Description :
From Genome Similarity Track
Location :
Scaffold_2703:190- 2687
Transcript NameFunction/comments
Phyta_totarag14754hypothetical protein
Phyta_totarag14755hypothetical protein PHYSODRAFT_326125

Sequence
2497 bases(100 bases per row)
ATGAGATGCGGTCTCCAACGGGAACAGANGTTTACAGTAGTTAGGACCTaaaagtgttattaatacagtcagtttagctttaaccaagaagttcaagtcg
ttcggtacccgGTATCTTATATGACAGTAAAGGCAggggcctttactacttaagacaacagagacgccgggcgtctgtcGTGGTTAGTACTctaacgctt
cctcttacgctaaggtgcgtgtgacccccgtcacatCCAACGACACAGCGTGAAGGTCTTTccgcgctgccgtcacaagttcccgctgctCGGTCAAggc
agtccaagatcgacacgagtacttcctccgagatcacccgaagaaCGACCCAGCCCTACTGACGGGTACACAAATTGAGCAAggtttttggcatccaaAG
GATATCGTAGTTCCCCCTCTGTTAGTTGGTGGTTCGAGCGCCGTGTGCATGAGAATCCCCGCGATTAGAAATTTCCGCGGTGCCGCTTCGCCATaatggt
gcgcgtgcccggGACTCGGGATTTCACCGTGAGTCCCTCCAAGAGGAAGCACAAACTGAACAAGGACACGGGAGAAAGCGTCGATGGAGATCGGATCACG
GACGATGCTGCTAAACCAAGATCGATCCGCGGATCGGCAGAGGTTTGGGAGGAGCTCTACCGACAGAACAGAAGAGGGTACGGCGACGGAATCGGAAGAG
AAACCTCAACCTCCTCCCCAGTTGAAGCAACGTCTTTCCTGTGCCCAGCGTGCTCGAACCTACCACCAGTTCCGACACGGGACCCTGGAGATTGCCGAGG
TTCTTCGGTCGGAGAACCAGCTTCACTGAGATCTGGATCAAGAAGGCATgcaagttcttcttgtagAATGCAccttccagctgctcctcggTCCAGGCTG
GCGTAGGATCGACGTAAtcttcgacgtcggcgtCCGCAgcttccatcttcttccGCGAGGGCTTAAATCTCGCAGACTTCTTTGTGGCACTCGATCTTGA
GCCAAGTGGTTGGTTGGATGAAGTACCTCCTGCTTTCGGTGGTCCTTCATCCGGTGGATCCCAATTCGCATCGAGATCCACGGGGAGTCCTTGGAGGGAC
CTACTAGAGGAGTCTGGGATCGTCGCGGGTGCGTTCGAAGCTGGTGACCTCTTCGATCTGAAGCTTGATGCGATCGATCATGCGCGCCAGACCCTCTTCG
AGACGGTGAAGCCCCTGGTTGACACGATCAGCCAACCCACCAAGGAGATTGTGAGATCGCAGCTTACCTCCCCTCCGTGCGCACAGACTGGTACGTCGTC
ACACTACGAGTCGGTGACCGAAGCAGTAGACTCCGACAGCGTCGATGTCCCGCCGCGAATGACGCTGGGACCATCCGGTGCtgccaagctgcaggatcGA
ACTGGCCGAGCTGAGCGCGAAGCAGTAGCTTTGACTCAAGAGACGAAGATCGCATTAGTGAACTCGACACGCCACTCGCAAGAGAGGCTGGAGTCGTACT
TTCAAGCTGCGATGGGACGCTTCCTGAAGGAACAACAGTCCACTCTCCGCCCGCGTGTCGTAAGACTgactggagatcaagacgtggagatggagtcgGT
TGGGTCACCCCTCTTCATGGGAATACGATCCCGACGACCTCGATCTAACCACGACTACTCGCGCAGCAGTGGCTacgacagcaacgtcacAGGCTACAAG
ATCGACAGCCGCCCCACGCATCCGTGTGTCGGCGATGTCCGAACTGAAGGAGTTCACTGGAAAGGAGGGCGACGAAGGTCGAGCCCGGTCCTGGACCGGC
AAAGTGAAATCGGCGTTCatccgagatcaagcgccTGATGATGAAAAATGCCTGGCCTTCGGTGATTTCTCACTGGGCCGGCTCGGAACTCGTACCGGca
gttgagcagcacgactCGCAGCACCTGGAAGGATCTGCTGTTGCATTTCCAGACACAGTACTGCAGCCGTGGTGTATCTGTCGCGAGACAGTACTATCAC
GCGAGGAAGCAATCCATCGAGTCACCGCTGGAATACCTGCATCTCCTCAACGTGGCTGGCGTCCGTGCGCTTCTCCAAGTGAAGTATAGATCTCCGGATA
CTCGACGTGATCATGTCGAACACTTCTTCGAGACGCTAGATGATCGTGATCTCCCCGACCACCTCGCCCTGCTGCGAATCCGAGATGTTGATACCTTGGA
GGAGACGTTTCAATCTCGACAGCGCACGAAGGCGTGTCGGAGCGAGACCTTATATGGTTCGATCAAGCCTAGGATGAgagcactggcagcaacgacaccG
TCAACCGCCACGCGAGTAGTTCGCACGATCCACGTGgccgacgacagcagtgGGTCGGAAGTGGAGTCGAGCGGACCCGACGGCGAAGCGGGATTGCGCA
GAGTGTATCTGACAGCAGCCGGAGATCATAGCGAGCCGCGATATCGTGGACCACCTGATCGATATCGTAGCCGTACAGGTCACGCATCCCGTGACCA