Description :
From Genome Similarity Track
Location :
Scaffold_3170:190- 1479
Transcript NameFunction/comments
Phyta_totarag15119hypothetical protein

Sequence
1289 bases(100 bases per row)
AGAGTCCTCCGCTTGGCATCAGGCGGAAgaccgaagacgaagtccATCGAGATGGACTGCCAACACTCCGACGGAGTCGGGAGTGACTGCAGTGGAGCCT
GCGAGAATGGAGCAGGCTTCACGCGCTGGCATACTTCGCAAGCACGAATGTACTTGCGCACCCATTTGTACTGGTGCGTCCAGTAGAAGTCTCGCGTAAG
AAGAACGTACGTCTTCTCACGACCCGGATGCCCTGCCGTAGGGGCATCGTGGTATTCGTACATGATCCTGAGTTTCAAGTCATGGTTGTCAGGCACGACA
ATGCGATCCGCGTTGTCGTCGACTGCGCTGTATAGCAGCAAGCCGTCGTGCACTCGATAACGATGTGCACGAGCGCGTAGGTGTGGAGCCATCTTCTGAC
GTGCTTTGtcagaaggtgctgacaCGTAGTCAAGCAATTCTttcgcgtctgcgtcgtgcgCATACGCGgccttcacgtcgtcgatcagaGACNCGCATCC
GATTGCAAAGTCGGACGCGTCACACACGACGTGGAATGGACGATCTTGATCGATCATCGCCAAGATCGGCGCCTCACTCAAGCCCCGCTTGACTGCATCG
AATGCTATTTGGCAATCGATGGTCCAATTGTACACAGCTTCCTTCTTTAGAAGCTGTGACAGCGGGCGAATCTTGCCCGCGTAGTTCTCCACGTACTTGC
ACAGGTACGTGGCAAGTCCAAGGAACTGCCTCAGTTCCTTGTCGTTGAATGGCCGGAGCCGTTCTTCCCGACGAGACACCCAAGCACGGGTATCTCGCTC
GCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTATGCTTACGCATCATCTCAAACAGCTTACGGAGATGCACCTTGTGCATCTCAACATCCGTCT
TCCCGTTCACAGCCCGGCTGTGAatgaacacgtcgtcgaagtagctCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGT
CGCAGGGGCGTTCTTTAACCCCTGCGGCATGACGAGCCACTCCCAAAGCATACCGCTTGGGGTGCTTACCGCCGTGAGAGGGATGTCGCTCTCACGCATC
AGGATCTGATAGAACNGCGCCAGCCGCCGTGTGGTTTCTTAACACAGAACGTCGGTGCACTGTGCGGGGACATGGATATCCACACTTGGCCTGCCTTGCG
ACGACTCTCAAAGAAGTCGTCGCTTGCTTTTACTTGCTCTCGCGACAGTAGCCACTGCCGCGTGACACAGTACTTCGTGCCCGCTACGA