Description :
From Genome Similarity Track
Location :
Scaffold_238:190- 1259
Transcript NameFunction/comments
Phyci_192905Hypothetical protein

Sequence
1069 bases(100 bases per row)
ggcggagccccttatcaccgagggtgcgtcgactcccggagtcgacgcgtcgtcgtcgacctgacctcttcgtgtcgacgattttcccatccgtatttga
acgttcctggaactaacacatcttcaccttccgacgtcggcagcaccgccaacgtgggccccacttgtgcgcgccctcgcgcacttcctgggcactccgg
gacaacagcattaagcgctgtctcgactggtaagccgcgcgcacctgctggtgcgtgcgctgcggtaacagggccatcgctctctgttccgctgtcgcgt
ccgaagcgcacgagcgtgcgcttcttcccgtctatcaccggatcacgccgtgcaagccacggcatgcccattatcacgtcgaacgtatcgtccaggccca
aaacgataaagtgttcgacaaacactcgttgtttgtacgagaagcgcacgttcaggacgcgcttctcggttttcacgatggcacctgttgccaatcgaac
ttctagaagactgcgaggtacatttacctcctcgaagtcaagactcggtaaactccgcagtcgaacaaagttgttcgacgcgcccgaatctaccagagcg
cgaagagagtcgctcgccctcttcgacgttaccttcaagatgaccaggttcggcctgtcatcttgcttcttgcagcgagatctggtctcagtgggggctg
cagtcctcagtggcccgatgtcggcacgcgtgactgcattaccagtagggtgcccctgcctactggatgctctcgtttttgttggtccgcggcgatgcct
agtatcgccacgacggccacctccatggggcatgggagctatgcactcccgtgcaaagtgaccgatccttccgcaacggaagcatcgcacattgcctccc
tgctgctggtaaccagcagccgttgcgttcgagaggtccattggttccggacctcccgtNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN