Description :
From Genome Similarity Track
Location :
Scaffold_201:190- 1192
Sequence
1002 bases(100 bases per row)
GAGAAGATAGCAGAACCAACTATAGTGCAACAAGAAGGAACGGTGCTGACAGGACAGCAAGTACTGCAAGCGTGTGGACTTGAAGAAACAGCAACACCAG
CAAACGGAAACTGTCAATATTATGCAGTCGCAGCAGCGCTTCTAAACCGAGAATTTCAAGAAACCAACAGCACCTACCCGCTTGAAATCCTTACCCACAA
ACTCAAGAAGGGTATAGCAGCCGCTAGTGACCATTTCTTTACTGAAGAATTTGATCACAACACTCGACTCAAAATCCTAACAGGAATCGAACGCTCAACT
CAAAACTTACGCCCTGGACAATCGGCGCAAGCTCTGAAAGCTCACTTCCTAGAACTGGGCAAATCGGAATCACGACGCAGTGGATACATTTCGGGACGTC
ACTGGGGTAATGACGAAACACTGCGAATGCTCGCGAAAATACTGCAGAGGAACATCTTTGTAGTGATAGCACGACCAGGACTGGCACAAGCGACGTATCA
GCAGTTCACACCGGCGCGGGTAACGAAATTTGGTAAAACATACAGCACAGCTAAGGAACGTAACTACGAAGCGGAACAAGCTCAGCATTGGATTAACCAG
ATTCGCCAAGACTGCAAGGAGCGACAGTCACCAGAAGAGCTACCGATAGTACTATTATTCAGACCAAAACATTATTGCCACCTTCGATTCAACCCCAAGG
CGGTAATAAAAGGACTTCAGACCGACCCTAAGCAAGCCGAACCCAAGGAAACCAGCTTAGAGGACGAAACTATGAGCTCTCTAAGTGAAAACACTGATGA
AGTTATGAACGAGCCAAGCGACGACGCAGAAGGAGGACCGAGTGAACAACAGCAAGCGGACAACAAAGCCAATGAAGGAGATCGACAACTTACAGCAGCA
GAAATTCACGAACGCAGCGAGGAGCAAATTAACGGAAAGGGTCGAGAGGAGGAATTACGAGTGTTCTCAACCGCTGGAATTGATGGAATTGCACCTGGTA
GG