Description :
From Genome Similarity Track
Location :
Scaffold_1501:19- 4182
Sequence
4163 bases(100 bases per row)
TTAGCCCTCTGCAATCCTTCGTCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCTCCCGTCGTGGATCCAACCTCCATTGCGTGGATCT
CAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAG
AGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTCTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCC
TTCGCCAACCATCGTCCGATCTCTTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGA
CTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGAT
CCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTC
CCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAAT
ACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATC
CACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCC
CCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCTAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATC
CACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACC
ACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCA
TGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGG
CTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGG
ATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCT
TGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAG
ATCTCGGGATCTGTACATCCCACGGTCCCCGAGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAG
ACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCG
TATGCGTCGGAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCTTCAAGCTC
GTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAATGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGAT
CCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGT
ATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATA
CCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTAACTTTGCTGATC
CATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTG
CCCCGGCCGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAATTCATCATGGGAGTTGTTTCCCTCCACTGACTC
CATCTCCACGTCTCGTGCTCCATGTTTGTGAAGCATTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCG
AAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGACGGTTACCTTGAGCCCGAT
CTGACGATAACCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGGTCCTGAGCCTTCGCGTT
CACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGAC
TCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACT
TAACTCTGGCAAAGAGGTCCCGCGTCGCGGATATTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCTTCGAACACACCAGCTACGATGCCTGACTC
CGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTC
AGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAG
CTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCATCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAG
GTACGGTGTTGGCTTAACCGGTGAGTCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCA
GGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACATAGTTCCTCCCAAAACTCC
ATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTG
GGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTT
ACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATC
TGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGTAGCAGTGGAAAATCTTCACTCTG
CGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGTTCTGGCCGTAGGGTTGCCTTGCGGGTGTATTCC
CTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTG