Description :
From Genome Similarity Track
Location :
Scaffold_1914:19- 2720
Sequence
2701 bases(100 bases per row)
GTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTACCAGTCATGAGCTGGAAGCGCTTCGCGCG
TGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACAAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACC
ACCACTGAGAGCGAGGACACTCTCAGTGCGAAGCCGAAGAAGGAGCGCTCTGAAGAGCAGAGCTGGGACTCGTTGAAAACGAGTCCCTACTACGAGATCT
TACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGATAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTA
CTGTGTCACGCGGCAGTGGCCACAGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGCCGCAAAGCTGGACAAGTGCGGGAATCGAAA
TCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGC
AGACACCGATACCGCGAAAAGATGTAAGCATCGAATCGATGGACAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGATTCTATCAGATCCTCAT
GCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACC
TTCAACAGATGCGTGACGCACTTGTTGTGCTCGGTGCGCGACTTCGCACCGAGCTACATCGACGATGTGTTCGTCCACAGCCGAGCTGCGGACGGGATGA
GCGACGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAG
CGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTC
AAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGG
ACGTCGAGTGGATTTGGACTGCTAAGAGTCAGCAGGCCTTCGATGCAGTCAAGCAGAGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCG
CCCATTCCACGTAGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCG
CGTCAGCTGAGGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTTCCGAATGTATCCACTCGGAAGCAAACCGTTCGTGG
TCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTTGCCGCACATCTCGCAACGGATGACGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCG
GGTTAAGTACAAACCCGGAAGACCCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCC
ATGCGATCGAGCACCCCAACATCGTCACTGTTGGACGATGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAACTCTTGCTGGCCTATGGCTCAGCGC
CTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCCGTCGACGC
CAACGCGGACCGCATTGTCGTCCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGTG
AAGACATACCTTTATCTCACGCGGGACTTCTACTGGGCCCACCAGTACAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGC
CTGCGCCTTCCGCGCAGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGAGTGTTGGCAGTTCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAG
CCAGGGGAACACGGGCATTGTGATCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCACGT
CTGTTCGTTGACATAGTGTTCAAACCCCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTA
CACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTCCTTAAGAG
CTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCTGATGGCGGCGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTAC
GTGAATGCCATCAGGCACCCACGCCCCCCCGAGTCTACTCGGGATGGTGGCTCCTTCATTAAGTGGGGGAGGATCTACGACTGCAACGCAGGAGCCGCAG
A