Description :
From Genome Similarity Track
Location :
Scaffold_1250:19- 2572
Transcript NameFunction/comments
g10218.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
2553 bases(100 bases per row)
CTGCCCGGCAGAAGCACTGCTTGTAAGCGTCTCGGTCCCTGACCGAGACTTGCCAGCTTTTTCTTGCTTGCGGTTACTTCTCGTGCGAGCCGGCTCCGCG
AGTTTCTCCTTGTCCAGGCCCGCCGGGACAGTTGTTTCCCTTGTTTCCGCCGGCGGGTTTTACCCGCGGGCAGCACGCGTTAAAGGCGCCGGCTTGATGC
GCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATCTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAG
AGTCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTTGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCTCCGGACG
CTTCGAGACCCTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGTTTCACATTTTATTCCAACGACTTCCGCAGTCGTTGTCGTTCGCTTGGGGTGAT
CGGAGACAGCCGCATTCCGCGCTATCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCT
GCTCCCGAAGCGCACGATCATGCGCTTCGTCCAGTCGATTACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGT
TCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGTGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCC
TCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAG
AGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGGTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCA
GCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTTGATTGCCCGT
GACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCAC
ATTCGTTGATACACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGACATC
GGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGA
AGAGATAGGTATTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGCCAATCGGGTTGGTCACGATGTTCGAGACCAAGTA
CCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCT
TGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGTTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATG
ACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGTAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCCCTCTCT
TCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACG
ATGAAACCCAGAGCAACACCGTGTTGCTCCGTCAGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTAACAGTCGTTGGAGGG
CCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTTTCCGAGGGCAG
GTTCTCAGCCCCGTGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTA
CTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAAATTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAA
TGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGG
ATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTG
TGGTGGTCACCTGAATGTGTGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG