Description :
From Genome Similarity Track
Location :
Scaffold_3352:19- 2565
Sequence
2546 bases(100 bases per row)
TGAAGATCAAAGGATGGGGGATCCAAGGTAACTGCGAGAACACGTGGATCATTTCATCGAGACGTTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTG
TTACGTCTTCCAGACGCAGATGAGCTTGAGGAAGTACTGAGAACGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCTGGCAAGTATC
GCCAAAAGGCTCCGACGCCTACGGCCCCAGATCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAAATGAATCAGGATCCGACGGTTCGGACTCCGA
CCCTGAAGATTACCGTCGGGTCTGTCTCACTGCGTCCTACGATCGAACGGCGAAGACAGGAGACAACTCCCGACCGGGGAATACCGTACCCGGGGACCGT
GGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCACAAGTCAGGTGTTCACAGCGGAAGCACACTGAATCTGGATGCTGGAAACATATGGCCTGTG
AGAAGTGTGGCAAGAAAGGTCATCCCGGAGATCATTTTTTCTACGTGTGTCGCGGCTATGGCGAGATTCACGACGTCGGCAAGTGGCCGATGGAAAAGTT
CTACAACCAGATCCGCCAATTGTTTGACCCAGCCAAGCACCGAGGGATGCTACCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGA
ATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAAGAAGACATCGCTAGTCCAGGTAGATCCAGTCGAATAATACAGCGTGATCTA
ACATGAGAGTGTCAGTTGCCAAGATCTCTTGTTTGGCGCCAGTGAGATGGAGTTGGCTAGATTCGGAGATTCTCTTCAAACCCGAGATTCTACAAAGGGG
AGAGAGGCGCGTGGTTTTTTTGTGTGGAGAAAACGCCAACATGGTCGATGTTTTGAGCCTACCAAGGGCGAGGTCACTGCAGATCCACCTAAGGTCTGTC
TGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCACGCCCCAGGAAAGTGGTT
CAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGTTGTCTATACTAGATATCGCCTTTGCTCGT
AAGGCTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACAAACGGGAGAGCGCGAATCAAGGTCACGT
TGGCAGGTTGTTTAGTGTACTGGTTCGATATTTGGGTTGGAGATCTTGCTGATCAAGACGCCATCCTCGGAATGGATTTCATGGTACCAGCCGGAGTGAG
GTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAAGATCATAAGG
GCGGATAAGACGACCTGGATTGAGCCCGGAGAGACCTGGGAATTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGA
AATGGGTGCCTACAGTAATCCAAGGACCAGGTCGATCACAATACCTCCCGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGAAGAT
CGGGCGATGGCTAGCGAAGGACGGTATCCATAGGCGACCTGGATATGTGTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCG
ACTACCGAGATCGAATCTCTCGGAGAGGTGAACCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGC
AGAGGGATCGTCGGATGGAGGTCCAAGCGATGGAGGTTGGATCCAAGACCGGGGATGATCCCCAGAGTCGGCCCCTAGACAACGCAGGATCGGTGGATGA
AGGATCGCCGAAGGCTGAAGCCGGACCGCCAGACCCCGCTGACCCCAGAGTGGATCCTAGCTTTTCATGGGGCAAGGTGCCTGGATCCTTATCGAGAGTG
GCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCGCTAGAGGACCGACTAGATCCAACCGGTGGCTTCCCCGATACCAGGGTACCTGATCCCACGA
AGACAGAAGGACTGCCAGATGAAAGAGGGTCGCAGTGCTTGGATCCAATGGTGGATCCGACGAAGACGGAAGATAAACAAGTCTGTTACCATGAAAGGTG
GGGATCTACACGCCGAGGATCTCGGGGACGGCCTGGCGGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGACGATAATCCAGGGGCAA
ACGAGCCCGCAGAAGTGGATCGGTTACGTCAGAAAATCTGGGAAAGCCGACATCTGCTGATTGAGTAAGGTAATGCATTACCGCCCGCTGCCCGCGAGTC
AAATGTGACATCGATGTCGGCGACGCAGAAGCGCGATCGCTCAAAG