Description :
From Genome Similarity Track
Location :
Scaffold_3237:19- 1962
Transcript NameFunction/comments
Phypl_g15710hypothetical protein

Sequence
1943 bases(100 bases per row)
CTTGAACTTACTATTGATATTATTGACCAATAGATTTGATTACTTGGTATTATCTCGGCTTTTAGCGAATCAAATTGATCTGCGCGAAcaattttgacca
atcagataGGTCGCGGATTGGTGACTGACTTACAGCCACACCTCCGACGTATCGGGTCGGAGGGAGCACTTAAGGTATTATTATCTCTCTACAGATGGCA
AGTCATTCGCATATTTCTCGAATAACACCCAAGCTCCGACACCTCCGACGCAAGATGAGCCTGAACGGCCTCACACCGGTAAAAACTAAGCTTGCTCGCG
AGTCCGCAGCGCGCTCGTTTCTGAAGTTcctcgaggaggaagacgtcAGTTGGGAGTACCTGGAACTGGccatgcagcgcgagcgtgcCGCGATTGTCCT
GGAAGCTgtggtggacaagtttgGCATGGACCTCGTCTTCAAGAAGGGCCGTAAGGTCAAGCTATTGGCTCGAAACTCGGTCATGTAGTACTACCGACAG
GCGAAGAACTGGCTGCTGGATCAGTCCCCTCAGCATCGAGCGGCCATTgacaagacgctgctcaagaagggGCAAATATTGGAGCGCTATTGCTTGAAGA
GGGAGTCGGGCGCCTTCATTAATAAGGCTTTTGCGTGCACGAAGTacgcgctcaagcagatGATGGCGTATCTCTGTTCGACTGCTGTTTTCTCCGCAGA
CTACcaggacgccgcgctgctgtgcttgctCTGGTTCCTTTTCGGGCGTGTTTCGGGCCTTACGCTGTTTCGCAAGGCTAACCTGTCCATCGGCGCGGGT
ggtgtcttcttcgtgcgGTTCATGCGGATCAAGACTGCCGAAGAGCAGGGCCTCTCGCTGGTTCCTGACGAAGATTTCTGCACGTGCCCACTGCTCGCGA
TTGCGCTTGCACTGGTGACCCAAGCTtctccgacggcagcgctgtTGAGCCAGTTTCCTACACCTGAGGCAAGCTCCCAAGCCACTCTGACTCCAGCTAC
GCCTCTCATCGACTTGGTCGACCACCCAGGATCTTCTGTACCGCTACAACCAACTCGCTCGGACGAAGGCAAGACAACTGACTCTACCCCGGGCATCCAC
AGCTACGTCAACCGCGTTCTGGAGAGAGTCGCTGAACAGACTGGCGTGACTAAGCGCCTCACATCCCATTCCTTTCGACGCGGTGGATCATAGCACACCA
ATGGAGCCGACATGTGTGTCCAGTGGATCTTCGACCGGGGAGCCTGGAATATGGCAGCTACGAACAAGGCCTTCGCGTACGACTTCAACACACCGGCCGA
AGATCACATGGTCGCTCGCGTCTTGAGTGGCCGGGATCCCGATCAAGTGGTCCCTGGATTGGTTCAACTCCGACACCCAGACGAAGATTCGAACCGTCGC
ATCGGCGCTACTCAATTCGTCCTACGGACTCAAGACAGCGCAGTACAACGTGAATGGAAGGGTACTTGATACTTTCACGACAtacctgctgcgccactat
ccatcgctgaagcagctcaaggcgggCGgacttgctgtcgagcgtcttgaagcGTGTGCAATTGAAAAAGGCTACACCATCAACGAGCTTCTAGCTTGGT
CTTCGCACCTGGCCTGTNCCGACAACACCAAGTCCCAAGACAGCACGAGCGATATCACCAAGCATCCAacgcttcttcatcaagcCGCTTTGATTGAACA
GTTAATTCAGATCGATCACAAGCTCGACGCTCGGCTGTCTACGATGGAAGCTAAAGTCTACAACAAGCCGCAACAGACACCAGGCACAAACGAAACAGGT
GAGGATACAAGCAATGAGCCACTAGCAAAGCgatgccgtgcagcagcagcatcaacaaaCCTGAAGGACGTCTGGTTCTCATGGTACACCCAAGAGCCCC
GCATATGGAGCTCAACCGATGGCGCCACCAAGCACACGAGATC