Description :
From Genome Similarity Track
Location :
Scaffold_1672:19- 1665
Sequence
1646 bases(100 bases per row)
ATAAGTCTTTTCCCGGCCCAAATGCCCACTGAGGGCAGTATCGTGGGCCTCAAAGAGGATTCGATATTTTAGATCCTCATTGTGAGGCATAACAATGCGA
GCGGTATCCGCTACATCTGTGCGATAGCACAAGAGGCCATTATTGATGGAATATCGATGTATGCTGGCCCGCAAGCGTGCCGATAATTGAATGAGTCCTT
GTATTCCTCACTACCAAGGGCATGAAACAATGCCACACACTGAGAATCCCGTGAATGTACCACACGAGTTAACTCCTCAATAGGAGACGAAAAAGTCGTG
ACATGAGCACGCTCATAATCCGGAAGGCGAGAGAGGGCATCTGCCAACACATTTTGTTTGCCTGGCTTATACTTCACCTCGAAGTTATATTCCGCAAAGA
AGGTAAGCCACTGAGCCATTCTCTGAGAGAGTTGAGGTGACTGTTTCGCCGTGCGTAATGACGCATGATCCGTATAGATGAAGAATGGCTTGAAGCCAAG
CAGATGGACTCTAAATTTGACGAGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGGACTGGATAGTTCTTTTCAGCAGCTTTCAGCTGACGTGATTCA
AATGCGATATCTCGCTCGCGGTCTGCAGCATCTGATTGTAACAGAGCGCTGCCTATGGCACGTCGGATGCATCGCAGACAACACTGAAAGGGTACTCCGG
ATTCGGCAACGCCAAAATGGGAGCATGAAGGAGACTCTCCTTGATTGACCGAAATGCTTCAGCATGGGTGTTGTCCCAGCGCCAATCTGTGTCCTTCTTA
AGGAGATCAGTTAATGGCCGAGCCATATCAGCGTAATTTCTACTGTATTTGTGTAAGTAATTGGCAAGGCCAATCCACTTACGCAAGTCCTTTTGACTCC
TAGGAATCGGCCAGTCCACAATAGCTTTGAACTTAGCGGGATCCGCTCGAAGGCCGCACTTACCAATGAAACAGCCGAGAAAAGGAATCTCCTCTGCATC
GAAAATGCATTTGGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCACGGCTCGCAAATGACCGATGTGGTTGTCAACATCTGACCGACCT
TTTTCGGCACGACTATGGACAAAAATGTCATCAAAGTACGTCTGTGCGTAATCCCTGTGTGGGCATAAAGTTGCGTCACCAGACGATTAAATGTTGCCGG
AGAATTATACAGCCCTTGGGGCATCACCAGCCATTCCCATAGCATACCACTCGGGGTGCTCACTGCTGTAAGCGGAATAGCACTCGCTTGCATGAGCAAT
TGATAATATCCATCGACCAAGTCGATTGCACTATACATAGTACAACCAACCATGTTGTTTTGAAGAACAACCTTTCGAGGAATGGGTGTCTGTGCCGGAA
TCGTAGCCGCATTAAACTTGTTAGAAGCATGCACAATACGTCACTTGCCGTTCGGCTTCTTAACACAAAACGTCGGTGTCGAATGTAGAGATTTACTCTC
ACATACTATTCCTGCCTCGTGCTTAGCACGGAAGAAGTCATCAATGAGATCACATTGCTCCTTAGGCAAGGGCCACTGTCGTGTGACACAGTATTTCGTC
CCAGGAACTAAGTCAATTGCATGACGGACACCTCTATCTGGAGGTA