Description :
From Genome Similarity Track
Location :
Scaffold_965:19- 1337
Sequence
1318 bases(100 bases per row)
TCCTAAAGCCATGCATCGGGTCTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGAC
ACTGGATCTATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGACAAAGAGGTCGCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGA
TATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTTGTTGGTGG
GTGCTCTCCCCCCGTTCCCCTGGGAATCTCCCATCTGGTGCGGAATTCTGGGAATCGGCCCGGAAAGGCAATCTGGAAGGCCGGAAGTTCCGGTAAAGCT
TGGTGGTGATACACCAACTCGAGATCCTTGTCGGACCAGCTTGACCTCGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAG
TCTTACTCGTCTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTT
CGCTTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCGAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGGTTTTCTTCT
AGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATC
CGACCTCCGACGACGCCTCTTCCTCTGGCTCAATCTTCACTTGAGCATCTTCTTGGCACGGTGAAATCCCGAATCATCAAAAGATCCGGGCACGCGCACC
ATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCC
GTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGCTCAAGTGGTGAAGCTTGAGTGTC
TTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATC
CGGGGCCTATATCGTGGATCTGGCCGTAGGGTTGCGTTGCGGGTGTGTTCCCTTGCCTTTATGTTTTCCTTTGCGTTATACTTGCCGCCTCCTGTGACGG
GATCTTGAGAGTTGAGAT