Description :
From Genome Similarity Track
Location :
Scaffold_6344:19- 1219
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_6344-snap-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
1200 bases(100 bases per row)
TTCAACTTTGCGTCGCTCTACCGATACGCGACGCCTTTGGACAAGCTGCTGCTCGTGCTCGGCGTCTTCATGGCCACGGTGAACGGTGCGCTGTTCCCCA
TGATGGCGATCGTGTTTGGTAACGTACTCGGCGGCTTCGCCAAGACGCCGGTCGACATTGACACGGTCAACACGGCTGCGCTCGACTACTTCTTGATCGC
GTGCGGCATGTTCTTCACCGACTATACGGCGTATATCACGTTCTACTACACGGCCGAGCGCCAGATGAAGTACTTGCGCAGCGAGTCGCTCAAGCACATG
CTGTACTTGGACATTTCCTGGTACGACAAGAATGACGCGCTGCAACTGTCCAGTCGCCTGTCGGGGGATACGGTCAAGATCAAGGAAGGCATGGGCCAGA
AGCTCGGCGACATGTTTCGCTTCACGACGCAATTTTTCGTGGGCTACATCATTGGGTTCTCGCGTGGTTGGGACATCACGCTCGTCATGGCGTCCGTTAT
GCCCATCATGGCGCTGTCGCTGTCGTGGCTCATCAAGACGATGCGCTCGAAATCCGAGTGGGCCCAGAAGGTCTACGCCGAGGCCGGCGCCGTCGCCGAA
GAAACGCTGGGCCAAATGCGCACGATCGCATCCCTGAACGCCGAGAAGAAGGCCCTGAAAAAGTACAATGACCACACGCGGCGAGCGGAAGCAGAGAACA
NNNNNNNNNNCTTGTTCCGCTTCACAACGCAGTTTTTTGTGGGCTTCATCATTGGGTTTTCCCGCGGCTGGGACATCACGCTCGTCATGGCGTCCGTTAT
GCCCATCATGGCGCTGTCGCTGTCGTGGCTCATCAAGACGATGCGCTCGAAATCCGAGTGGGCCCAGAAGGTCTACGCCGAGGCCGGCGCCGTCGCCGAA
GAAACGCTGGGCCAAATGCGCACGGTTGCATCTCTCAATGGCGAGAAAAAGGCCTTGAAGAAGTACAATGACCACACCCGGCGAGCGGAAGCAGAGAACA
TCAAGCTGGCCAAGTACACCTCGGGTGTCTTTGCTATGTTTCTCGCGAGCATGTGGGTCATGTACTCGATCGGGTTGTGGTACGGCGGTCACAAAGTCTC
GATCGGCAAGACCAGTCCGACCGAAGTCTTCCAGGCCTTCTTTGGTATTCTCATGGGCTCGGGCTCGCTCGCGCAGATCTCGCCTAACTTGACGGCCGTT