Description :
From Genome Similarity Track
Location :
Scaffold_240:18998- 24687
Transcript NameFunction/comments
Phyta_totarag6052ABC transporters ABCA family

Sequence
5689 bases(100 bases per row)
ACCAGTTCCGCTTGACCGCCCCATCCCCTCAATTGATTGCGTGGTTCTTTTCTTACGTCGTCCGTTAATCAAAGTCTCGCCAGCTGAACCTGATGCATCA
CTTCACCTTCCACCTCGTCACTCACAGATTTGCGGCATGGCGGACGCCGGATCTtccgacgacgccgagagCGCGACACTAACAGCGCTCCGAGACTgcg
tcaccaccgtcttggAGAACGACGTCGCGTACGGCCTCTGCGTCACGAACTCGGGGCTCTTCGACCTCCTGCCCGACGAGTTCCTAaacgccaacaacaa
cagctcttcaagcagctcttcggcctccttctcgtcctccagatcttcttcagacgacgacgacgatgaatTTACCGGAGACTCCGTCTGCCGCGTCATG
TGCTCCAAGCAgtcgacgtcggcgtccagctcgtgctgcgaCGCGGCCGCCACGCTGCGCGCCTGCAACACTTCGTCCGCAGCCGTGACGTCGTGCAAAG
AGCAgttcgacagcgtcttcacaTACCAGCACGAGTGCGACGGAGGCCTCTCGTCCGCCAACACGATCTTGATCGTCGTGGCGGTCGTCGTGGCTGTCAT
CGCTGCGGGGGTTGCAATCTTTGCCAGACTCTACGGACGACGCAGTGTACACACAGGGACAGGGCTCGCTGCCAAAGTGGCGGCCACGTGGAGACAGATC
ACCAACTTGGTGTGGAAGAACATGgtgcttcgtcgacgacgcccCGTGTCGCtggcgatggagctgctcttgcccgtgctgctgtccacggtgctgctgc
tgctggcaaacCTGGATAATCTGGCGGGAGGGTGGAGGTCGACGTTCTTCACGTCGGAagcggcggtgctggacgccaatGAGACGCTGATCTGCAGCGA
TCTTGCTGTCTGGGGACTTGAGGCCATTGGAGGACCGTCGTCTACTATGACGTCGTTCTATACAGGCGGCCAATCTGTCCTGgggctcttcttccttgtG
AGTTACATCAAGTTCGtgtccacgacgacgaccacaaTGGTCATTGAGAAGGAGAGTAGACTGCGCGAGGTCATGAAGATCATGGGGCTCTCAGATGCCA
CGCTGCTCTGCTCGTGGTGCCTCAcgacagcgctgctggccacgccGCTGGCCTTTGTGATCGCTGCGGAGCTCAAGTTTGGCAACGTGTTCCCGACAAC
GGAGTACGCGACGCTGGTCTTCCTCTTCTGGACGCTGAGTGTGGCCATCACGGCCTTTTCCTACTTCGTCGCGCCGTTTTTCAACAAGTCCCGGactgct
gccatcgcttcggtgctgctgtggcttaTTCTTTTCTTCCCATACTTTGCGGTGCAGTCTGCAGACACGAACACGCCGCGGTACTGGGCCGCTCTGGCCC
CACCCACTGCGTTCGCGCTGGCTGTGGACGATATTTTGCGCCGTGCTCAGCTTGGCACAGGCTTTGCTTATTCTGTGGGGCTGAGCGAAGCGCCTGTGAC
AGTCCCAAGCGCCTTCAAGATGAGTCTGTTCCTGATCCTCGACTCGGTCATCCTTGTGGCCCTTGGATGGTACTTGGAGCAGGTGTTGCCCCAGCAATAC
GGCGTGAGAAAGCCTTGGTACTTCTTGCTCACGAAAAGCTACTGGTTTAGCAAGATCGATCAACCTTCTGAAGATGATACTCTGAGGAGTTCAGACATgc
acacgacgtcgacgctgtcgccTCAAGCTGGTGGCGCTTACACGCAACTCGCAGACGGAGAAAGGACTATCAAGACACACAAACCAGTGGCTGGAGATGC
GTACGTGGAGCCCGTCAATGCGGCGCTAGCGATGCAAGAGCGCAATGGTACGTGCCTCCAGATACGGGGCCTGCGGAAGGTGTTTccacttgaagaagat
ggcgaggaacacgttgcagttgctggattGGACTTGGCGATGTACAGCGGACAGATCACTGCGCTTCTGGGTCACAACGGTGCTGGTAAAACGACAATCA
TCTCCATGCTTACTGGTCTGATCCCGCCCACTGCAGGAGATGCGACGTTGTATGGGTGCTCTATCAAGCATGACTTTCAGGAGCTGCGGCGAGTCATTGG
CATTTGCCCGCAGCACGACGTACTTTTCCAAGACCTTACTGTGGAAGAGCATTTGCTTCTTTTCGGCACGATGAAGCACGTTCCTCGCGATAAACTCCGT
AGCAGCATGGACAAAATGATCGAGGATGTTGGGCTGACTGAAATTCGCCATGCACTCACGAAGACGCTCTCTGGTGGTCAAAAACGGAAGCTCAGTGTTG
CGCTCGCCTTCCTCGGTGGTAGCAAGCTGGTCTTTTTGGATGAGCCTACGTCTGGCATGGACCCGTACTCTCGACGTTTCACGTGGAACTTGCTCCAGCA
GAGCCGTGAGGATCGCGTCATTGTCCTAACGACTCACTTCATGGATGAGGCCGACATCCTTGGTGATCGCATTGCAATTCTAGCGGATGGTCAACTGCGG
TGTGCCGGCTCGTCTCTTTTCCTAAAGAACCGCTTCGGCGCGGGCTACAACCTGACCATGATCAAGGCCTCTGACGGATCTTGCGACGCGCAATTGGTGG
AAGCTTTCCTCAAGAAATACGTTCCTGGTGTGAAGTGCCTGAGTAGTTCGGGGTCAGAGCTCGTGTTCCAGCTGCCGACGGCCTCGTCCGAGGCGTTTCC
TACGATGCTGGAGTACCTGGATGCCGAGATGCATGAGCTTGGCGTGCAGCAGTATGGCATCTCGGTCACAACACTGGAGGAAGTGTTCCTGCGTATTTCT
AAGGACCACGAGGAAGAACAGTATGAAGCAGAAAGAGAGGCCATGTTGCCAGCAGTGGAGCGGAAGCCCTCGGTATCCACATCTCTGAAGTTGGTGTCGG
CAGGAGGTGCAGTGAACTTGCCTTCAGCGCGTCCACCAATCACTGATCCATCGATGTGGACTCAGTATTTGgcgctgacgaagaagcgtTTTCAGATTGC
CAAGCGTGACAAGAAGACCCTGGCGTACTCTGTGGGTATTCCATTCATCTTTTTGGTCATCTTGGCCATTCTTCCGGAAATTGAGGTGGCGGACTTCATC
CCCAACTACGCCTCAAGTCTTCCTACGGATGCACAACAGAGTCAATGTGTCGCGCCAACCAATTTCAGCAGTCTCGTGGATTCGGACTACAGTGTCTCGA
CATGCACGAGTTTTCGTGGCTTCGACTACTGCACACTTGGTGTCATTAACTGCGACGTCAACGTGTGCTGCGATGCGACTAACATCGCTTCTCCGTGGTA
TCCATGCAGCACATGCGGATCGGCTCCGtgctacaacaacaactgtCTCGCCAAGATCAACGCGAAGCTGCAAGTGACGCTCAATGGCTTCTTGGTGGCT
CTTGTTGTCATGCTGGCATTCGCCTTCATCCCGGCAGCTATCGTTGCTTTTGTCGTCCGTGAGAAGGATCCAGACCAGAACGCCAAAAGTCTGCAGCTCA
TCAGTGGCGCCAATGTCTCGGCGTACTGGATGTCAAGCTGGACGCACGACCTCCTCCTCACGATTTTCCCCattgctgccgctgcaatTGTCATCCCGCT
GTCCATGACACCGAGCGGTGCAGCGAAGGCTGGCACAGCGGATGTGTTTGCTATCATTGCCCTAGTGGTCGCACATGTGTGGGCGATTATTCCACTCGCG
TACCTGTTTTCAAGGCGCTACGTCAAGCACGCTGTGGCACAAACGGCTTTGCTTGTGTTTGCTTTGGGCACCGGTGGCTTACTGAGCATTTTTTCGTTCA
TGTGTCGGATCGTCAACTTTTCAATTTCGGGTTCCTTGACGCTTACATCGCTCGACCGGAACTACTTGCGGTGGATGTTCATGATCTTCCCAGGCTACAC
GTTGAACAACGGCATCTTCGAGCTGGCCACGCGCAAAGTGAGTCGTCGGGCGCTTTTCGGCTCTGCTCGTTGGTTGAGGGCGACTCCGTCCTTTTTCGGT
TTGTTTGAAGGTTTGGGGAAAGAAGAATGCACGGAGTGCTGGGACCGTATAGAGCCTTCGTGTTGCGTGAGGCAGCCGTTTGATTTGGAGGTCGTTGGTG
CGCCGCTGATGTACACGTtggttgaagctgccgtGCTGTCCGCGCTTGTATTCATACTTGAGAATCGATCGGTTAAGTGGAAGCAGTCGGCAGCAGGGAA
GAACGGGAAAGCTCAACATAGTGCCGTAGAAATGAATGCTGCTGACACtgcggaggaggaagaagaggatgacgatgtACAGCGTGAGCGACAGCGCGTG
GAGCAAGAAGCCCCTCGACCTGACGATCTTGTTTTCATCCGGAACTTGCGACAGCAATATGCTGGGAAACCACGAGCCAAGGTTGCACTGAAGGACTTAT
GTCTGTCCATCCCAAGTGGCGAATGTTTTGGCTACCTGGGTATTAACGGTGCCGGAAAGTCGACGACAATGGCAGTGTTGACGGGCCAGTTGGCACCCAC
TGAGGGCTTCGTCACACTCAGCGGCTTTGATCTGTCAACTAGTTCGGCTTCTGCGCGAAAGACTATGGGCTACTGTCCTCAGTTTGATGCGCTCCACGAC
CTGCTGACcgtgaaggagcagctgcagttgtaCGCTCGGATCAAGGGCATCTCGGAATCTTTCGTGAACACAGCAGTGGACGAGCAGATCCAAGAGTTGG
GCCTCACGAAGTACCGCGACAAACTCACACAAGGTCTCAGCGGTGGTAACAAGCGCAAGGTGTCGACGGCCATTGCACTGCTCGGACGTCCTCGCGTAGT
ATTCCTCGACGAGCCTTCAACAGGCGTGGACCCAAGCTCCCGGCGAAAGATGTGGGACGTCATCGCGCGCGTGTGTTCGACGGATCGAGATGGCAGTCGC
GATGGAGGAGCTTGTGTGGTCCTCACCACGCACAGTATGGAAGAGTGCGAGGCTCTCTGCTCTCGCGTGGGCATCCTCGTAAGTGGTCGGCTGAAATGCC
TCGGCAGCGTGGAGCACCTCAAGCAGAAGTTCGGCCGAGGCTACTCGGTGGAAATCACGCTGCGCACCTCGGGTGGTGACGCCACGGAGCTGAAAAGTGT
TATAGACCAGGTACGGACGTTCCTCGCTGCCGAACGGAGTCTGTCGGCGCGACGTAGCGGTCGAACCAGCCAGCGTCAGAGCTCGAGCAGTCTGCAAGTG
AGCAATGGCGCGAAGGTCACGTCTGCCAACGTTCAAGACTTGTGCACTGTCTTCGGGGCCCCTGAACGCGGCGCTCGCATTCTGAGCCGCTCGGGTACAG
GTTGGCTGCTCAGCAGTCAGCTGGAGGCTCAAGGTTCGATCTCCGTCGACACTTTCTGCTCGTGGTGGGTCTCTGAAACTCGCGGTGAGAGGCTGCAGAG
CTTCTGCCAGACCAAGTTCCCAGGCAGCGTCCTCGCGGAGCAGCAGGGCGAGCACTTCCGGTTCCAAGTGCCGAAACACCGACCCGACAGCGATGCAGTA
TTGCGTCCGGCCGAAATTTTCCGCGCACTGGAGCAAACTCGCACCGACCTCAATGTGGACGAGTACAGCGTGAGCGAAACTGCACTGGAGCACATTTTCA
ACAACATGGCAGCACAGCAAGACGAGGAGAAGGGTGTCGCGCACGGCATGAACATGCAGTAGCCGCTCaattttaattaaaataTTCAT