Description :
From Genome Similarity Track
Location :
Scaffold_3:1898963- 1900946
Transcript NameFunction/comments
Phyin_T30-4PITG_02392Putative uncharacterized protein

Sequence
1983 bases(100 bases per row)
GGTGACCCGGGTCACCATAATGACCCAGCTCTCACAACCCTTTTAAAACATACTTTTTAAAACGGGGCTAATAAACGAAGCTACTCACTTACCTTTTGGT
TTGAATAAGGAGAGTATAGGTGTATTCGAAGGTGCCACCAAACAGGTTTCTTAGCTGGAGGCTGTGCTCAGGGGGCTGTCTTCCGCTTAGTGACACTCCC
CATGACGAATCCAAGGATCGGTAATTTTGTTGCAGCTGACGGACAGTGTCTTCGCCCAGTGCCTCGCACTAGAGCTATCACGTAAGCTGTCACCTATAGA
TGGTGCCTCGAGCACGATCTATAGGTGACAGCTTACGTGATACCTCTCGACGGCGACTTGGTATCGTCTGAGCCGATCCCCCGGAACCTCCTGTTCGACG
CCGCGTTCTACCGTCTTCATCGACACGACTGTCGCTGATCATCCCCTCGATGGATTCAGTCTGGTTGCACGCAGGGATGCTCTGATCAGGAGAAGTTGGA
GCTGCTGCGAAAGGTTGCCGATCGCTCATGAGCTCACCGAAGCAGAAATGGCAGCACCAGAACGACTTTTGGATCGACTAGAAATAGATATGTGAAAAAA
TAAATACCCCTTGGTCCACTTTTTTTGCGGTCGCTCGGGTCATTGCCAAAAGTTTCAATTGCGGAATTATACCTAGCTGAAACCACACTTTCCGCGTCAT
TTCTTCGCCATATTTATTGGTACCGGTACATGAATTGAGAGGTGTATTCCAGGGCTAGGGATTACTGAAAGGATTGTCTGTATTGTACTTTTACTACATG
CGAATTATAAATAAAAATTCTACAATTAAAAGGCATCGGAGATCAATTATATTCTCTCTAAACTAATATCTCTTGCCTTGATAAGACCCCTGTCCACAAC
ATCTGGGATAAGACAAGCATATACGTCATTCCTCCTCTACCTGGCTGAGCCAGTGGCTCAGGTGAACACACGTGAGACTTCAGTAGACCATGTACGATTC
CAGCACTTTAGTAAGTCGCGGTGGTGGCAGCAACAACGTAAGCTCTAACGTCGATGCAATGGAGGCTGGTCGACCTGTGCGTTCACCCACCACCTCACGT
CGCTCGAGTCGCACATGGACGTATGCGATGGCCTTTTTCCTAGTGATCGTCATCATGTACGCCGTCACGCCGTCACCGGTACAAGTGCAGCAACGTCCAG
CCAAGAAACTCGACGTGGAACCACAGCGAATTATCATTCATGACGATCTACCAACCGTGGACATAGCGACCCACAAACCATCGTCAAGTCAGCAGGGTAC
CAAGTTCGACTCGAGTGTCAAGCGTGACAAGGGCATCATCATGTGTATGCACAACGATGCAGTCCCCATGGGTCTGTCACTCGTGCGCGAGTTGCGCTGT
CTTGGCAACCAGGAACTCGTTCAGATCTACCACTGCTTTCCACAAGAGATGTCGGACGAGAACCGCGCACTGCTACTAGACGCTGACACCCGTTTAGAGA
TCATCGATGTGTGCACCGACCTTGTGGAGAGGAAGGTGCTGACGCAGAAAGTAGCGGAGGAATTCCGTAGCTGGTGGGTCAAGCCACTGGCCATGTATCA
TACCGACATTACCGAAGTGATGCTGCTAGACATCGACGATGTGTTCATGCACGACCCGGCAGTGCTACGTACGACAGAGGGCTACAATAAGACAGGCACA
ACGTTTTTCTATGACCGCGTGCTGTTTAGCCGCGAATTCTTTAACCAAGACGTGAACGGTACCTCTTACCTCAAGCGAATGCTAAACGACTTCGACTACG
CAAAGTACGGACTCGGATCTGGAGCTCAGCCATCGAAAGGGCTCAAGAGATCGTATGCGTATCGAGGCATGTCATCTCACGAGCAAGACTCGTCACTCGT
CGTAATTGACAAGTCTCGCTCTGGTCAAGCCATGCCGATCATGCTCTGGCTTATCACAGAGGAGCGATTCCGGCGGGAGTTCT