Description :
From Genome Similarity Track
Location :
scaffold_13:1898607- 1902691
Transcript NameFunction/comments
Plaha_PHALS_06491Molecular chaperone (DnaJ superfamily)
Plaha_PHALS_06492Junctional membrane complex protein Junctophilin and related MORN repeat proteins

Sequence
4084 bases(100 bases per row)
TTCTGGCGTCAAGATGAACGTGACTATTATACTCTTTTAACTCTACCACGTGATGCTTCAAATAGTGACATTCGAAGCCGTTTCTTGTCTCTTTCACGTG
AATTTCATCCAGATCGTCGACGACAAGGGAATGGCGAGATTGTAGCAGCTGCTAATGCACAATATGCAATTCTTGATCGAGCTTATAAAGTCTTACTCGA
TCCTGTGAAACGTCATGTATATGATATGTATGGTGAAAAGGTATTGTATTATTTTGTAGATAATCTTTCCTAATATTAATATGTTTCTAACCTTTGTATA
TTTAATAATTAGGGATTACAAGCGTATGAACAAGATCAAAGTTCCCACCAATATATTGTTGGCACTCATTTCAATACTCAAGAAGATCTTCACGAATATA
TTGAAAATCTTTTACGTCGAATGAATGAACAAACTTTAGCGATCAAGTTTCCATTCCATAGTGAAATGTCCATGACAATTGATGCTTCAGACTTTCTACA
GACACCAatgaaaggaatttcaaatcTTTTCAATCATGGAAAACAATATCTCGATCGACCAGAAATGACATTTCATCAACGTACGGAATTTTTACTTTCA
CGTCAAACATCATTGACAATTGGAGGATTTTTATATGATCGAAATGGATTAAGTATCGGAAGTTTTACAACAGGAATTTCATACAAATCCTTCACTCCAA
GTTTTCCATCGTTTACATTATCAACTCAATTAGGTTGGCGACCTAAAGTTCAATGTCAAATGAGTCAACAAATTTCACGATATACAGTTTTGATGTTCAT
TCCAGAAATTGATGAAAATGGAATTGATCTTTCTATTGGCATGAATCAACTTTTATCTTCACAAATGCATGgaacgatgatgtggagtACACGTGATGGT
TTATCAGGATCGTTAAATCATGATACAAATCAACAAAATGCTACTGTTGCTCTTGCTGTGAATAGTGCTGGACCAAATTTGACATTTCAACTTCGTCGAA
TAATTGCAATGACATCAACAATAAAAGTTTCAATACGTGCAAGTTTATTAACTGGAGTGTCATTTGTGACTGGTATAAGTCAAGAAGTTTCTGATCGTAC
ACGTCTTGCTATTGGTGTTTTACTTGCACGTGCTGGTATCACACTTCGTCTCGGATTTACACGTGGTAATGTTCGTTTTGTGATGCCCATTTTTCTCTCT
CCTTTTTCAATTCAATCAGCATATTTTACCTTTTGTGCTGCCACGTCACCATTTCTTGTGGCTGCAGTTCTTTCTCAAATTATTAAACCGGCACAAGAAC
GTCAACGTCGTTTTGAACGTCAAACTCGTGAAATGATGCAACTTCAGTATCTTGCTACTGCATTTCAAAGTGCTCAAGAACAACAGAAATTGATGCTTCG
AAGTGCAGAAGAAAAGATGAAATTAGAACGTGAACGAAGTGATGGAAAAGGGTTGATGATTTTGTTAGGACGTTATGGAAAGAATCCAACGAATTTGAAT
GAAGACAATGTGGAGGAGAATGATGAGAATTTTAGGTTTGAAGATGAAAGTCACGAGACTTTGATCGTACAAGAAACGACGATGAAACATTCAAAACAAA
CGTGTATTGATGTGACGATTCCACTTCAATTTTTTGTTAAGGTAGCAATTTGAAATGATGAAGTTTTGATTGATTGTTTAATGTCAAGTTTTATTGTAGA
ATGGAGAACTTTGTCTACCTTCCGCATCAAAAGCTGGCCTCTTAGGCTTTTATAATCCATGTCTGAATGAAGTGGATTCACAAACAGCTAATTCGTCGAC
TAACAAACCTTTGCTGTACGAATGATTGAAATTATGAACTTGTTCTTCATTTCTTAACATTCTTTTGAATGCAGATATATACGATATGTGTACGATGGTC
AAGTGTTTGAAGCGACTTTTGATGATCATCAAGCTGTTAGTTTGCCATCAAAATACGCTCAAGTGATGGGACCTGCTGGACGTGTGTACTAGCATTTTGT
AGCTTGGTTGAGAATGTTATTTCTTTAGTTGTTTCATCGTTCAATGACTCGATAAAGTGATCGACAAGTACGTTCAATGCTATTGTCTCGTCATCTTTTT
GACATTTCTCGAGTTCTAAATGTTGTTTTACGTACAAGATAGTAGCAAATGCCTCCAAAAAGTCGGAATAGTTCAATTTGGTACCTAAGaaaaacgcatt
tgactCAATTTCATTGCTAGTTTCATATTGATGTCTTCCGATCTTTAAACATTCAACTGGAACAAGTGGAAAAGAACATTCAAAGGCTTGATTGAGTGCT
GCAAGTGCATTACTAAGTTGAAAGTCAGGAGTAAAGATTGATGATTGATTATAGAGCATGGTAAGAAGTGATTGAATCGTCACATCTCCTTTGGTGATCA
TTTGATTAGCACATTTCTCGTACAAGGATTGCAAATGTTGATGATGTTTTATGAATGTACAGTGCAATGATTTACTCATTAACTCGCTTCGAAGACATGA
CAACCATGTAACTTGTTGATTCTCTTTTATACGATGACGTTTAATCATCATTTGATTGTAGAATTCTGAAAAAATCTCTGCAAGAAACTCAGTGTTGTCA
TAATTTTCAAATAATTCAATAGATCCATCGACATGAGCCATTTGAACCCACGAAGATGCAATTCGTACAAGCAATTCAAGAAATTCTCGAAAAAGAAGAA
CTTGATTATGTGGTACAACATTCAAACGAGTGAAGTTAAATGGATCTTTGTTATCGTTTGATAAATTTGCAGTTTCTTCAATAAAATTCATGGAAGACGC
TTCAGTTAAAGCTTTTGTTCGTTGTGCTGTACGGATATCATTTAAAAAGTTTTCAAGTTGATTCTTTGACAAGTAAAAGCCACAATGAAACAAAAGTTTT
CGACATTCCACAAGTTCTAAACGATTTCCAACATCTCTGAAAGTGACACATTGACGTGATTCTTCAAGATATTCACGATATAATGTACGCAATTCAGTAT
TAAGACGTAAAACTGAATGTACAACAGCTTCTTGAGCTTGTTCAAGCTTTTGAATGTTTAAAAATGAAAACAGATCGTTAATATACAACATCACACCATT
TTCCTCGACATTTGGTTTagaaatgacaccaaaattaCTTCGATCTTGATGATAACGACCAACAAATACACGTCCATCTTGATAGAAAAAAAGACCCCAA
CCAtctttttgattttctttCCATTCACCTTCATATTGTGCTCCATTTGAATAATAAAAGACACCACGTCCATGACGTTTTCCTTGATACATTTCACCTT
CGTACCAATTTTTATCGTACATTGTACTTTGATACCATACGTATCGTCCAAATCCATGTGGTCGATCATATTTCCAATCACCATCGTACATTTCAAGGGG
TATCTTACGACTAGTCGAGTCAAGTGTAACCCAAGTCATCACTCCATGTCCATGTTTCACATCGTCTTTCCAATCCCCTGCATACATACTACCGTCTTCA
TAATACATAACTCCATAACCATCTCGCTTTCCAGCTACAAAGTTTCCTTCGTATCGAACATTGCGTACATTATCATATACTAATTCACCGTAACCATGTG
GTACACCATCAAACCATTCACCGGAATACCGACCAATCTTTTTGACGTCTAAATGcatttctttttcatttttagAAATAATACCATTTGAAACTTTTTT
ATCTTCTTGCTCTTCTTTCGTAGCTACAACACCTTGTTCCCCCGTCTCAAACACTCCATAACCATGTCGTTTACCACATTTCACGTCTCCAATGTATTTA
CTTCCATTTGGCCACCAATACGTTCCTTTTCCAGTAATTTCATTATATTTTACATCTCCTTCGTAAGTAATATTACTTGTATGCCAATTAATACGTCCTA
TACCATGTAATCGACCATAATAAAAGTCCCCAGTGTACGTAAAGTTCGTTTTAAATACTGCTTTTCCTTTCCCATGATACACTGGATCATCACACTCTGG
TATTTGTACTGTCTTTCCGTCATACTGATGTAATACATGTGATAGTATGCGAGAATCTAATGGTCGTACAGAATTCTTCACGAC