Description :
From Genome Similarity Track
Location :
Scaffold_14:189845- 202882
Transcript NameFunction/comments
Hyaar_Emoy2802608hypothetical protein
Hyaar_Emoy2802609AP-3 complex subunit delta, putative
Hyaar_Emoy2802610Glutamine cyclotransferase
Hyaar_Emoy2802612U6 snRNAassociated Smlike protein putative
Hyaar_Emoy2802611U6 snRNAassociated Smlike protein putative
Hyaar_Emoy2802613COMM domain-containing protein 2
Hyaar_Emoy2802614AlNc14C130G6940
Hyaar_Emoy2802615phosducin-like protein
Hyaar_Emoy2802616hypothetical protein

Sequence
13037 bases(100 bases per row)
ATGGCGTCCGTAAAACGATTGAATTTGAGCAAGTCACGTGATGACGACGAAAGCTCGTCGGCTTCTTCAATTGGTGACGAACGGGAGCAAGAGGCATCGT
CAGAGAGGCCGGAGGAGGAGGATTCCAGCTCTGACGAAGATTCGGACAAGTGAGTGGCCAATAATAGCGCGGTATTCCGGCTAAATTACAGCACACTGAC
GTCAATTTTGAATCAATACAGGGACTTTGAGATTCCACCAGGTTTTGAAAGTGTCAAGGGCAGCGGAGCGATGACACGAGAGGCGGTGGTAAATATGGAC
CAAGAGCTCTGGTTCTTTAAGCTACCGAAGAGTGTACGTGGTTCCTTATCACAACTATAGAAACAATTGAGGGAGCGGTGAATTGACTAATATTACTGTT
GACTTTTGTTCTGCTGCTACAGCTGGACGCATCAGCACTTGCCAATGTGACGTTCAAAGTAGGTGAGGAAAATGTGGTAGTGAAGCCTGGAAAATTGCTG
GCCAAGGTCACGGCCGGTGAAGACAATAAGAAGTACTTGCTGCAGACCGAGGACCGCATGCTCACAGATCAGCTCGTGAATGCTCTGCCACTTGCCTCGG
ATCGTTCCCGCTTTGTGCTGGGCAAACCTTTTTCACGTTGTTTTTCGCTGGTGGAAGACCGGTTTGAGGCGCCACCTACAGTATCAGAGAAGAAGACGAC
CGAGGTAGATCGTGGATCGCCTGTCGTGGAGAAGCGTCACAGAAAACACTCATCGGAAAAGAGTGAGACGCATAAGTCCAAGAAGGTGAAGCACAAGAAG
TGAGTCTGATCGATTAATCAATACCCAACAGACCGTCGAGATATATTCTCGGTAGCTCAATTTTGATCTCCCCCATGATAATTCCTATATCAAGAAAGGT
TATCGTCTAAAAGAGCAGGAGCGGTTCTTCTACCACTGTCTCTTGGCGTTTGGAGCTCTCGTGCCTGCTGTCCCTACTCTTCTTGCTCTTCTCGCCGTCG
CCACTTCTTTTACTGGAGCTGGTTCTCTTGTGGGTACTGCTTTTCTTACTGCGGTGATGGTGACGGCTCTCCTCTACTACAGCAGGCTCCTGCTTCTCAT
CGCTGAACCCTTGTATCAGCAGATCCTCCTCGTTCCGTGAGGACTTCTTGGACTTAGATCGCTTGGATGATGACTCCTTTTTCTGCTTGCTCTTGTCCTC
GCCACGAGCAGAACCTTTGTGCTTTGAGCTTTTCTTTTTAACCTTCTTTTCGGTTTCAGCGAGTTTAGACGACGGTGTCTGACGATGGAACCACTGATCG
GTGGGAACCTTCTCGTCTTTACCAAGCGGGGTGCTCAAATCAACTGCAGCTAAATCCGTCTCCTGTAAAACGTCAGATTACGTGAAGGTCAGCGAAGAAG
GCCAAAAACAAGAAGACCTAGCATCGCTAATGAAACGCACATCTTCGTTGGCAAAATCACGCTTCTTTCGAGTGCGCCGGCGGTCTTCATCACTAGAGCG
TGCACCATCAGGCATCAGATCGTCCTCGAAGATATCACGAGACTTTGACTTCTGAAATTAGCACAAACAGACGTCAAGGTGTTATCAACGCATGGTGCAG
AACACCCCAATGTACTCTATCAAACCTTGGTTCCCTTCTTCTTTCTTCCATTCACGCCAACACTCAAAGCACCCATCATGTCCGCAAAACCCTTGGTTCA
ACCAGAATATCATGGTGTGAGCTAGGTGACACAAAAACAGCAACGATTCACCCATAATTCTTACCGCGTTGGCTCCACCATTAGCAGAAGCCTGCGAACC
GGCAGATAGGTAGAAAGGATCTTTGCGTTGCCGCTCTTGCTCGCGCGCGCCTTCACGTTTCTTCTTTTCGTTCCTATCTGCGAAACCCTCTGACTCCGAT
TCCGATTCCGACTCGGAAGAAGAAGAAGGGTCGTGATGACGACGATGACGGCTGTGTTTATGACCAGGCTTCCGCTTGGAAGATGCATCGTCAATACCAC
TATAGCCGCCGCCTACACCAGCGTGACCCTGACTGACGAACGAGATCTCGAGGTCATCTTCGTTCAAAAATGCCGATACATCACCACCCGTTTCAAGAAA
TTTGGCCTCTGATGTACTTAGAGGTTCGTTAAGATCGAGGCCATCTGGTACTGGTACTTTTCGCTGAGCCTTAATGCCAACAGGAGCCAACCGCTCAGCA
AAAAATGCCTTCAGCACATCCAAGCGCTCGACCGCATCAATCGATGCACTGCCGTCAAAGGCGCGTTTGGTACGTTCTTGTGTGGTTAGCGCACCAAGCC
CCATGCTCAATGCAAGCAGGAGCTGCTGTAAACAGACCGCGCGTTCTTGCACCTCGATATACTCGCTTTTTACGAAAGATGGCAGGTGCTCCGCAATAAC
TGTTGCAATACGCTCCACAGTGGCGTCATCTGCGCGTTCAGCCATGGCAGTAAGGATTTTCAGAAGTGACTGGAGGAAGACAGTCTGAACGTGAGCAGGC
AACATAGCCATTCGAGGTTGGAGCATTTCGTCTACAAGATCTTCCAACCGCTGAAGCTTCTCCTCTTCGGTCTCGGTCTCGTCATCCTCCTCTTCGTCCT
CATCTTCATCATCATCCACATCTTCCAAAAACTCCGTGATGTATTCACCTGTAATCCAAGCCGCTGCATAGTACACTTCCTGGATAGTGCCCACCCCTGG
ACCGCTAAGTGCCTCTTTTTCCATTAGTAACTGAATCATGTTGTCCACCATAATGCTACGCACGCCCTTTACACGGACCGCAATGTCCACAAGCTGGCGC
GCTACCTCTACACCATGCGAGGACTTTTTCCTTTCGTTATCTGTCCCATTTACCTTAGTACAGCTACTGCTGGAGCCAAGCATGCTGTCGCACGATTGAG
CTCGCGACGACGACGACAGTGACGCATCAATTGTAGCAGCATTATTTCCTGGTACGCGCGCAAGCTGTACCAGCACGTGGATATACCAGTCAAAGTCGTG
AATATTCGCGTACTTGCCAACTGAGCAAACATGCAAGATGTGTGTGATGAGCTCATGGCGATAAGCACCATCGGCGCCCAGCGTCTGGCGCATGAGCTCA
CGAACGATAGGCGCCGCGTTGTCGGGGTTTACCATGGCAGACAACAATTCCAGCGCGCGCATGCGGATCGTCATATCGTCTACAGCAAGACATTCAACAA
TAACCTCCTGGTGCTCTGCGACGACGTATAAATGGGATTTCATCAAATTCCCTAAACCAACGAGACCCAAGTAGCGCAGGTTTTGATCCGTGTCTTCAAT
GTACCGACGCAAGTGGTCATTACAGAGCCGAACAACTGCTGCCACATTACGCGGCTGCGATCCGTCACTCTTTTTCGTGTACATTAGCGCGGTTGCAACC
GTACTGATGCACTCGTAGAGCAGCGATTTTGCTGGTGTGTTTTGAATAACAGTCGCCAGTGGATCCAAAAGTTTGCGAGCAAGTCGCGGCTCTTCCGGCA
CCAAACTCGCCAGCAATTTGACGACTTTGATCAGCATCCAGTTGTTCGACGATGTCGTAAGTAGACGGAAAAACTGTGGTGCGAGTCCTAGATAGTTCTT
CGGTTTCTTGTTCGCGAGCTCGCAAATCACATTCACGGCACACGAGACAACCGTAACATCTGGTTCTTCCATCCTCTCCTTGAGTCGATCAAACGACAGT
CGCAGCCCTTGTGGGTAGCGCAGGAACATCTTGTAGAGCACCAGCGTAGCTTTCTTCCGAACGTACGGCTTGGGTGAACCCATCATTGCCAGTACATCCC
CCAATAAGTCTCTTGCCAAGTCCGCTGTGACAATATTAGCCAATACATTGATCGCCAGTCCCACGTCGTACTCGTTTGCACTGCCAAACTCCTTCTTGAG
TAAGTTCGTACATAGCAGCACCACGTCCGTCGACTGTGTAAAGCTCTGACACGCAGCATTGTAGCCAATGCGTTTGTGAGCAAACCTCTCATAACTCATA
ACCTCCACAACGTGAAACGCCGCCCAGCACATGTCGTAGCCCAACATGTGGAGGTACGTGAGCTTGCGCACGGCCTGGGCCTTGATGAACGGGTCAGTGC
TGCGCAGTTCCGTCTTGATCTCCTGCAGCGCCTGCGAGACGTAGTTCGTCACGTCGCCCTTGGTCGAGCGAATGCCCTTGACCAGGTCCTGCAAGTTCTT
CTCGAACATGGCGGCTATTAAGTCGGTTGACGCCAAGCGCGAACGAAAATTTAGCGATATAAAAATACACACACAGAGGGGGGAACACTAGAAAACACAG
TAGATAGTGCACGGAACTTGAACCCGGGTTGATGAGAATGACTTGCGCTTTGTATGCGAAACGGGTGGCGACGTGAAATCTTTCAGGTAATGTTATAACT
ATCTAGAGTGCCAAGTAGACAAGTTAGAGAGTGTGCGAGAATCGTTTTGATTGCAAGGATATGGCAAGATGACTGTATGAGGGTTGAGAACGAATTGATC
AATGATCCTTAACAAATTGACAAGACGAGACTGGAGCTAGTTTGGGCTTGCACGATTTGGACTTCATAAGTAGCGGTTATAGCTCTCAGCCCATGACCAA
CTCGAGTAGAATCATGACCGTGTTGATCGCCATCAGAGGAACTGCGTCAAGAAAAGAGCACACATAGATAATACAAAGTTAGTACTTACTCTATAATACT
ACCGATGTAGTAGGCAGTAGGACGACCACGTACAGCGCAAATACTGCACAGCAATGAGAAAGCCCACGATTTGGTTCTTGATCGTCAGACCTTGCGACGA
GTCGACCTTGTGCCAGCCATCTACACGCAAAAACAAAGTGTTACCGCACAATATTTGCCAGCACCATGGTACCTCCGGATATTATAGAACGTACGGGGAC
GCAAAAACCGCTTTTCGTGCAGAATACACACGGCATTTGTGAGCAATAGACTCGTCAGCACGAAGTTCCAGAGCACGCCCATGGGTACGATTGTCCTTCG
GAATGATCAGATAATAACCAAGTGATTGACTGAGGAGACAACAACAAACATCAATCAGAGCGACTTGATTGGTCGAATATTATGCTTTTCAAACAATTGC
ATTGATTGACACCTTTGGCCAGCTGCTGGAAAGGAGGTGGTGATGGCTCGTACCCATGTGTCCAAACGACCGAAGCGGCAAGGGCAAGCAGCTCCATCTA
CACGAGAAAAAAATCGCGAGAGTGCGACAAAGGAGATTAGTAGAGAAGAGAAAAGTGGAATGCTGCTGACTCTTCTTGCAAGTTGTGGCGTCGCTCTCGT
CGTAGTGGTTCTTGGGGTGCTCCTGCGACCGACGCAGCCTCAAGTGCTAATACCGACGCCTGTTCATGATTTGAACTCGGAAGAGCAAGCGAGAGTAGAA
GCACGAGAAGAGAGACCAATGGATGCGCGTCCTACGGTCGAATTCCTGGCCAAGTATCCACACGACGCTGCGGCGTTTACTCAAGGCTTTACGGTTGTCA
ATCGAGGCAATGAGAAGCTCTTTATCGAGTCAACGGGGCTCTATGGAAAGTCGACTCTGCGTCGCGTTGATATTGAGAGTGGGAAAGTGTTGAAGCAGTA
CGATCTGCCCGAAGAGCTATTCGGAGAAGGCGTGACGCTCGGTCTAAACAACGAGCTGGTCATGCTCACGTGGAAGAGTAAGTCCGGGTTTGTGTTCAAC
CTGGACGAGACCGCAGATGGAGAAGTAGACGGCTTTGCATTGCACAGCGAGTTCTCTTTTGACACCACTACTGGTGAAGGCTGGGGTATTACTTTTGACG
GCAAAGATCTCGTCGTCTCGGACGGATCGTCGACCGTGATGTTCTGGGACCCTTTGACGAAGAAAGAAGTGAGGCGCATCGAGGTCACGATCTATAATGG
TAATCAACCGATCTCGCATGTCAATGAGCTGGAAATCGCCAAGGGTTTCATCTACGCGAACGTGTGGTACCAGCCGTACATTTTGAAGATCGACCCAGAG
ACCGGTGCCGTGGTCACTATGTTCGACTTGTCAAAACTTCTTGCAGACGCTGGAGCTGACATATCCGCCGGGGAAGTTCTCAACGGCATCGCGTACGACG
ATACTGAAGACGTATTCTACGTCACGGGGAAGCTCTGGAACTCTGTCTACAAGGTCCGTCTTGTCGACCCTGTGCAGTAAACTGTGCCGAAGTACAAAGC
ACACTTCTTCTGTTGTGCGTCATCATCACACGTACACGACTGGGGTACTTCATGCTTACCTAAGACTCAGTGTGCAAGCTGTTAAACATTTTGTTTTGGA
CCTTAATCACTGCACCTTGTTGCACTTAATCTGTGCTGCTTTGCTAGCCCTCTTGCTGCAGAAATGGGTTGGGAATCTCGGCCGTTCCGTCCATAGGAGA
GACGAGCATCACGGACGTGCCTCTGCACACCACAAGTCCAACTTTGCGGGTCTCGTCCGTGATCCGATACTCGTCGTTGGGGTCGCGCACGAACTCGACG
CAGTCGTCCAGCACCAGGTTCACTAGCTGGTCATATCCTTTGAGCATCCCTGTGACCACACGCCCACCATGGAACTTGACGCGCACTTCCTGGTCAATGT
ACTTGGCCAAGTCCAGGATCGGATCCTTGCGATTACCACCACCGCCATTGCTGCTGCCGTTCGCTGCCATTATTGCTTTGGATTTTGAAGTACACTACTG
ATTGGTTGAAACTTTTCATCAGAGTCAGATAGAATCAGACAATGTACATTTATCGCTGATCATCATGAGCAGGAGCTTCGCGGTGGACGAGCGCGTACTG
AACGCCGTCGCTCTGACCAGTGCACTGTCAGTTGAGGGTACGTCCTGTATCTATTGAGAAGACGTTGATATGATGGTATAATCGATTTTTAATGTGTGGC
ACAGACTTTGAGGCTTTGTGCAACTTGGCAGTGCAGCTATTCAACCCGGACAAGCAGAGCAAGCGGATGTACAAGCGCACGGCATGTGGGTACAAGCGCA
ATTCGACCATAAGCATACCCGGTACCAAATGTGGTGTCGGTTGTGATGGTAGTTCACGTGATGATTGTATCCTGCAGCGAAGGCTGGATGGGAGAGCGAG
CAGATGGAGCATGCGGTGCTCGCCGTCGCCAAGATATTCATGGACGGTGCAAAGGTCGGTAGTGTGTGAGTCTATCCTGCAGAGTCGCAGTAGTGATGGC
ACGTGTGTTTGTGTGCACGTGCAGGCCAGAATGTCCGAGCATGCGTTCCGCTTGGTAATGAAAGAGATGTTGTTACCGGAGCAGCATGTCGACGTGCTCG
TGCAGGTGTGTGCTTGATCTGTATCATCCAACTGTTGAGGCGGGTGTCGTGACGTGACCGGTGGTTGCAATTCCAGTTATTTGATGCACACAGGACCGAC
ATTCGGGAGTGCATTTCGAAGGATATGGGCACGAGCGTTCCGCAGTATCGGAACTTGGAGTGGCGCATCGATCTGGAGGTAAGATTCTGTGATATGCTTT
TGTTCCAAGATCACTGCCCCTGAACTTCAATTGCAATCCAACAGCTCGGTACACGCTTCTGCCGCAACAAGCCAAAGCCTGTTGTCACTCTTCGGCTGGA
TACTGCCACCCAAGCTAGCAGCTCCGCCGTACCGCAGCTTCAGACTACTTGTCTTCGCGTCGACTACGACGGACTCAAACGGATGCAGCATCAGCTGGAG
ACTGCACTGAAAGAGGTTGAATCTGTGCACTGCAGTCGCGTCCGGCGCTACATATAATGAAAGACGAAAAATATTGACATCCAGACATCCTCTCCGATTA
CTTGTCTCTCGCTCGGTCGGCGAAATGCTGCTCTTTCGTCTTGGTGAATGCCGTGATCTGGTCCAGCTGCTGCTGTGACTCGTTTGACTTGTCGCTCTTT
TGCAGCAGCAACTCTGCAAACTTGGCCTGCTTCTTCTTTCGAGCCTCCAGGTCGGGCTTAATCTTTGCTTCCTAACCGCAGAACAAACAAAGCACAGCCA
TATTAGTCACCAAGGCGAGAAGCAGCACGTACTGCCAATGTCAAGTTCAGTAGAACTACGCACCAATTCAGATCGGATCTCCTCATTCGATTTTGGATCC
CAGTAGATGTAGCATAACGTAATAGCGAGACCAAACCGCAGGGAGTAGTCAAGCATCATTTTGGGCACTTTCATGGTCGATAAGGCTTTGAGTGTGAACT
TTAGCCGAACCTACTGTGTACAATTTTGACTACCATTCACAAATTGACAAACCAGCGTCATCATGCGAGCTGCTACCAAGTTCCATCGCGTATTTCGACG
AGCTATTGAGACATCCAGAGGCACTGCTCGGTACTTAAGCAATTCTACAGCAGCAGCATTACCAGAAGGTCTTGAGGAGATCTACAGCGTCCCATCCACA
CCATCTTGGTCACTCAAGGAGCTTCACCAGGAAGGAGCCGTACTAAATGCCGCTGATGTCGTGCTTACGGAGGAAAAGGTGCGATTTACAGTAGTTTTTT
AAGGAATGCAATTGACAAACAGAGTTTGTATCTGTATTCGCTGTCGTTCAAAAGCTGCGGGAGCTGGCTGAGCTGTGCCATCTACACCTGGACGACGACA
AGGTCCCGGGGCTGCTGAAGGACGTAGAAGCTATCATTCAGTGCACCAAGACCATTCAGGCCATGACGATCAGCGACAATATTGATGACGTGTACTCGAC
GAGCAACTTTGATGCTGGTAGGTGCTGTTGGCGTTTGTACTAACGGTCTTTGGTATCTGACATGCTGGCCGATGTGCTGGTCTGCATCTGGTGTATTGCT
GCTCAGACATTGTGGCTCCTCTTAGGGACGACGTCGTCACAGCAGGAGATTGTGCAGACAAGATCTTAGCAAACGCTGCAGAAAGGTCTGGCTACTACTT
TAAGGTTCCCAAAGTAATGCGGGACTAAATCATAAACGACAGCAGCGATTAAGAAAAAGTGAAGCGCCTTTGTTCGAGGCAGAATGGACTTTCAAGGCAA
ATTAATAGCATTAGCCTCACCAACTTAAACATTCCGTCGACCAACAACGGAATCAACCGTCCACTTTAAAGACGTTGGCCTTAGCCAGACACTCTTCCAA
ATCTGCGCGCAAAACCAGACAGACAGACAGAATCAATCCATACCATCAACACAAGCTCCCCACAACGACATATTACACGCCATAAAGCTCGGCACCTACC
TTCCACCTTCATGTCGAGTCCGTTGAGCTTGCGAATGCCCAGGACCTGGTTCTGAAGCGCGCCCTTGTGATACATGAAAAGAGTGGGGCAATTCCGCGAC
GGCCACTTCTCAATGCAAGCTTGGGCCTGGATGCTCACAAACTTCACATCACAGTGCCTCTTGGCCACCTCCCGCAGTACGTGGTCCATGACCTTGCACT
CTTCGAGCGCATCGTCCCACAAGTAAGCAATGACCCAATGCTCGTGACTGCCGTCCGTCACTTCCTTTGTCCACTCGTCCTTTGCAATAGGTTGCACGTC
ACCAAACTTGTTGCGTGCCGCCTGATCCTTCATCTCTTGGATACGGCGCTCTCGAATACGCGCCAATACCGCGTCGTCATCGTCCTCGTCCTCCATGTCA
TCCAACTCGTCCAGCGTAGCGTCCTCGCGAGTGTCCCCCCGCTCCTCGTCTTCCTGTTGCTCCTCATCAGGCACCTTCGTCTTGGGTGCAAGGATGCCTT
TCTTCACCAGAATGTCCTCCCACTCGGTCGTCTCGCCCGTAGGCGCGTAAAATACGTTGCCACGGTCACCCATGATATGTGTCGACAAACTGGCTCAATG
GGATGGATGAATTTGGTAATGAACATGGGTACACAAAGTCACCCTGATTTGAGGGTTCAAAACGGCTCGGATTTCGACCCTGATTTGATCCGCAAGCTGA
TTCTTATATCCGAGTCCGGTTCCAACCGCGGGAACGGATATCACTGGTCAATTTGATATAGGTTCATTAAAATGGAGACCATGAAGGAGATACCTGTGAA
CGTGAATGGCAAAGGCGCTATGCAGCTAGTGACGGCGCTGCGATCCATGAAAGACGGTCAGGTACCTGCAGGAAGAGACGTGGTCTTTACGAGTGGAGAG
GACGGTGTCTTGTTCGTGACGGATCTGGCGACTGAGAGCTCCGTGTATCAGGTTGAAGTGTGCGATGGGTTCATCCCGTCTTTCGTCGTGACGCCCGAGC
AGAACCACGTGCTCATTGCTTCCGATGATGACTGCAATGTGGCTTCATACAGTCTCCCACCTGATTGCCACTTGGACGAGCTGCTGCGTCGCTCGACGGT
CTCGATCCGCCAAGTCACATGCTCGCCCCAGTTCATTGCCATTGTTGATGAGGAGCCCGTGGTGCGGGTGCTACTACGCAGCAATATAGAGCAAGTGATC
CTTGCTGAGGGTTCTACTGGAATTATCAAGAGCGTGGTGCTCGACCCGCAGGAAAAGTATCTCTGTACCAGCAGCGAGGACGCGACTGTGCGTGTTTTTG
CACTGGATGTGCCAAGTCAACGTGCCACAGTAGCCAAGATTTTTAAGATAAAGCATGGCAATATCAGACATGACGACGTGCTGCTGCGGTGTGCCTGGCA
GCCGGGGGAGGCTGGTAAGTTGCTGGCCGTGCCAATGGACAAAGGTATTGTCGAGCTCTTTGAAAGAGCCACATGGGTGTCTAAGATCAAACTGATGCTG
CCGATTGGCAAGAGCACTGCCGCTGATGTAGATGTACTGGCCTTCTCGCCAAACGGACGGTACTTGGCTGCGGCCACGTGTGCAAAGGAGGTGTTTGTTT
GGGAGCTGGAAACGCAGACAGTCTTGCGTTCATTCAAGATTGACTACCAAGCATTGGGTGCCCAATTTGCAAACAAGAGTAATACACTAGTGGTCTATCA
CATTGGCGGGAAGCTGGCTTTTGTCAAGGATGTGGTCCCGCCGGGACATACTCCACCCCAGCACATGATCGAACAGTCATTCGCTGCAGGTGCGAGCACG
TTAGTAAAGGCTCCGAAACAGGGAGAAAGAAAGTGTGAGGCATCAGACCTTGTGAGTGACGAGACTGAGGTGGATGGAAAGCACGATGCTGACAATGACG
AGGAAATGAGCTTCGACGATGACAACGAAGCACGAGTGGAAGCCATCAAGGCTAGCTTTGGTTTTGGCTCTGCCGCGAAGACCATGATCGATGAACAAGT
CGAAGACAACAAGAACTCTCTGACGAGTCGACCCAGTAAGAAGTTGTCGGGTCAGAGCGCTTCTCCTTTGCGGACCATTACAGAACCCTTCCAGCCCGGT
AGCGTTATGGACACTAGTGGATGTGGCAGCAGTGCTACCTCGTTGCTGGCATGGACTCCAGAAGGCGAGATTGAGGTGATCCGAGGAGCCGGTATGAGTG
AACACTTAGTCAAGGTGGACTTTGCGGACAAGTCTCGTCGGGGATTCAAGTTTAACGACAACTACATGTTCTCGTTAGCATTTCTGGATGATTATGGTGC
TATTTTTGCCACCCCGAGACGTGCTTGCGAAGATTGGGAAGACGTTGAAGCAGATACTGACGAAAGTAACATTGTGAGCAGCTTCATTTTCTACCGCCCA
TTCGAATCGTGGGCAAGCAACAGCTCGTGGCACAAGGCATTACCCGAAGGCGAAGATGCTGAATGCGTTGCTGCAGGTCGTGAATTTTGTGCGGTGGCTA
CCTCGTTGCATACCCTACGAATCTACACATCAAGTGGCCTCGAGTATGCGCTACTGCGACTCGCTGGACGCGTCGTGACAATGACGGCAAAAGAGTCACT
TCTGGCCGTAGTGTACCAAGGACTGCATGGACAGATGCTCTACCAGCTCCTTCGTATAACAGTGGGCTCGTTATGCGATCGCGTCAAGCTACTCTCGAAA
GGTGAGCTGCCCATGACGCCGCCATCACGGGATGTATTCGCATCACATAAAGAAAACGACGTGATACGCGAAAGTGTATTAAACTGGGCGCAGCTTACAT
GGCTCGGCTTCGACGATCGCCAGATTCTTTACGCAGTGGACTCGTTCTCGTGCATCCAGGCGTTGTCTCCCGGCTCAGGATGGAATTGGATCCCTATTGG
CTGTGTAGGCAACACACTGCAAAAAAAGCCTGAAGATCGTCACGGGGTCTTCACACTAGGCGTCGTTAATGACTCGTTGCTTTATTTCCCGCTGGAAAAG
AGCGCTCGAGCTCCTAAGCTCCGCGGTAGTCATCGTCCGGTGCCCGGTATGTTCCCGCTACGCATGGCGTCTTTCCCAAAGACGTTAAAGCAGAACGATG
ACGTCTCAAATGGCCAAGTGTGGCAGAACGTGCGGCTATGCGGACTGGAGTCGATCGCGAGCGAGTTGAACGCGGATAAAAATGTAGCGGATCAAGTTGT
TCACGAGCAGGCAGAAATGGACAAGGCACTCATCTTGATGATGAAGACGGCTTGCACGAATGACGAGTCTGCACGCGTGCTTGATTTGGCGAAGTGCTTG
CATCTGAAAAAATCGCACCAGATCGCACAGAAGCTCGCTATTCATTTCTCGTTGCGTCAGCTGCAATCGCAACTCTATGAGCTGTACCGCGTTAAATTTG
AAGAGCCTCAGCGTCTCAATCAGGCGTCAAAGATACCAACTTCTCAGCCTCCTCGGCAGCCCGCCTCGTATCGCTCCAGCCAAGAGGAAGAGACACCCGA
GCCACGAGAAATGGAGCCTCTTCGTCGTGCACGTAGCTTACTGTCTCGACCGCTGTCTACGCCTTCTCGTGATGAATCTTGTGATAAAGAAGCTGGTTCT
ACTGAAGACGCCCAAGAATTGAAGCCCTCAGCATTACCGAAAGCTGCGTCTACGAAGGAGAGTGCAGGTGTGGAACGGTCCATGGCCCCAGCGAATCCGT
TCCTGAAAAAGCCTGGCGGTTCTTCAGCATCCCCTTCTGGAGGCAAAGGAGAAAAAAAGACTGGTTTGCAGCGGATGGCGAAGTTTGCGTCGCCTCCACC
TACCAAGAAGCAGTGTCGGTCGACGTGGAATAAATGA