Description :
From Genome Similarity Track
Location :
contig_13:189817- 191384
Transcript NameFunction/comments
g2989.t1RAW31030.1 Cleavage and polyadenylation specificity factor subunit 3 [Phytophthora cactorum

Sequence
1567 bases(100 bases per row)
CCGCATCCGCAAGCAGATTGCGATCTCGAACCCGTTCCAGTTTGAGCACATTTCCAACTTGAAGAGCATGGACGACTTTGACGACTCGGGCCCGTCGGTT
GTCATGGCCAGTCCTGGTATGCTGCAGAGCGGTGTCTCGCGCCAGCTTTTCGAGCGATGGTGCTCGGAGCGATGGTGCTCGGACAAGCGCAATGCTTGTC
TGATTCCTGGTTATGTGGTCGAGGGCACCCTTGCCAAGAAGATTCTGTCGGAGCCGACGGAGATCGCTGCGCTGGATGGACGCATCATCCCCATGAACTG
CACGGTGGAGTACATTTCGTTCTCGGCACACGCTGACTTGTGGGTACGAGCGGCTTCGTGGAGAAGCTTACACCCCCGAACATCGTGCTCGTCCATGGTG
AGAAGAACGAGATGATGCGTTTGAAGTCGGCGCTCAACAAGAAGTTCAACGACCCCAAGGTCTATCACCCGAGCATCTTTACACCTGCCAACATGCAGGA
GATTGTGCTGGAGTTTAAGGGCGAGAAGATCGCCAAGGCTATCGGAGGTTTAGCGAGTGACCAGCCCAAGAATGGCAAGGTGATCTCAGGTCTGCTGGTG
GAAGTGGACTCGCAGACGCATTTGATGGACAAGGAAGATCTGTCAACATACACGAAGCTCATCTCGGGTAGCATTACACAGAAGCAGCACGTGCCATTCG
AGTACAACTCGTTTGACGTGCTGATCACCTTCATTCGTCAGATGTACGAGGACGTCGTGCATTTGGAGAAGGAAAACCGCGTCGTAGTGTGTAAGCAAGC
CGTTGTGACCCGATGCGCTGTTGCTAAGGGTGCTGCGGAGAAGCTTGCGATTGAATGGACATCTGCACCGACGGCTGACATGATCGCCGACTCGGTCATT
GCGCTAGCCATGCATGCCCAGGCAAGTCCTGCGAGTTTCAAGCTAAGCAACCAGCCTACGGCTGCATGTCCGCATGACCACTCCAAGAAGGCGGACGCTA
CTGAGGAAGCTATGAATGACGAAGACGCTGTCGTGACACCCGAAACGGAAGAAACTCCTGTTGTGGAAGCCAAGGACATTGCTGAAGATCCTGTATCGGA
GCAGCCCCATAAGAAGGAAGACGGGTCTGACCTGGAGAAGGCAGCGCAGGAGCTTGGAGAGGCCGACCAAGACGCACTAAACTTGCTGATCGTGTTCCGC
CTACTGAAGGATCAATACGGCGATGTTGATTTGGACTTCGAGACCAACAAGATTCACGTGCGAACTCCAAGCGGCATCGATGCCGTAGTCGACCATGCTT
CTCGGGACGTCGAGTGCAAGGACGCAGCTTTCAAGCTTAAGCTCCAGACGACTGTCCGCCGCATTGAAGGTGCTCTGAAGCCCATTGCATCATCGTAAGC
GGTGCGTTGCTAGCCAGTCTGTGAAAATGCTGCACAAACAATTCACCTATCTGCGTTTACGGGGAGTTCCACGCCAAGAAAAATACGCGTTCATGATCAG
ACTATCCGTTGACTTCACGCAATATATTCACCTCTTTGAGAGTCTTTTGCAATCTAACTATCAGTAT