Description :
From Genome Similarity Track
Location :
contig_13:189815- 191381
Transcript NameFunction/comments
g2835.t1RAW31030.1 Cleavage and polyadenylation specificity factor subunit 3 [Phytophthora cactorum

Sequence
1566 bases(100 bases per row)
GGTATACCAGACGTACATCAACATGATGAACGACCGCATCCGCAAGCAGATTGCGATCTCGAACCCGTTCCAGTTTGAGCACATTTCCAACTTGAAGAGC
ATGGACGACTTTGACGACTCGGGCCCGTCGGTTGTCATGGCCAGTCCTGGTATGCTGCAGAGCGGTGTCTCGCGCCAGCTTTTCGAGCGATGGTGCTCGG
ACAAGCGCAATGCTTGTCTGATTCCTGGTTATGTGGTCGAGGGCACCCTTGCCAAGAAGATTCTGTCGGAGCCGACGGAGATCGCTGCGCTGGATGGACG
CATCATCCCCATGAACTGCACGGTGGAGTACATTTCGTTCTCGGCACACGCTGACTTGTGGGTACGAGCGGCTTCGTGGAGAAGCTTACACCCCCGAACA
TCGTGCTCGTCCATGGTGAGAAGAACGAGATGATGCGTTTGAAGTCGGCGCTCAACAAGAAGTTCAACGACCCCAAGGTCTATCACCCGAGCATCTTTAC
ACCTGCCAACATGCAGGAGATTGTGCTGGAGTTTAAGGGCGAGAAGATCGCCAAGGCTATCGGAGGTTTAGCGAGTGACCAGCCCAAGAATGGCAAGGTG
ATCTCAGGTCTGCTGGTGGAAGTGGACTCGCAGACGCATTTGATGGACAAGGAAGATCTGTCAACATACACGAAGCTCATCTCGGGTAGCATTACACAGA
AGCAGCACGTGCCATTCGAGTACAACTCGTTTGACGTGCTGATCACCTTCATTCGTCAGATGTACGAGGACGTCGTGCATTTGGAGAAGGAAAACCGCGT
CGTAGTGTGTAAGCAAGCCGTTGTGACCCGATGCGCTGTTGCTAAGGGTGCTGCGGAGAAGCTTGCGATTGAATGGACATCTGCACCGACGGCTGACATG
ATCGCCGACTCGGTCATTGCGCTAGCCATGCATGCCCAGGCAAGTCCTGCGAGTTTCAAGCTGAGCAACCAGCCTACGGCTGCATGTCCGCATGACCACT
CCAAGAAGGCGGACGCTACTGAGGAAGCTATGAATGACGAAGACGCTGTCGTGACACCCGAAACGGAAGAAACTCCTGTTGTGGAAGCCAAGGACATTGC
TGAAGATCCTGTATCGGAGCAGCCCCATAAGAAGGAAGACGGGTCTGACCTGGAGAAGGCAGCGCAGGAGCTTGGAGAGGCCGACCAAGACGCACTAAAC
TTGCTGATCGTGTTCCGCCTACTAAAGGATCAATACGGCGATGTTGATTTGGACTTCGAGACCAACAAGATTCACGTGCGAACTCCAAGCGGCATCGATG
CCGTAGTCGACCATGCTTCTCGGGACGTCGAGTGCAAGGACGCAGCTTTCAAGCTTAAGCTCCAGACGACTGTCCGCCGCATTGAAGGTGCTCTGAAGCC
CATTGCATCATCGTAAGCGGTGCGTTGCTAGCCAGTCTGTGAAAATGCTGCACAAACAATTCACCTATCTGCGTTTACGGGGAGTTCCACGCCAAGAAAA
ATACGCGTTCATGATCAGACTATCCGTTGACTTCACGCAATATATTCACCTCTTTGAGAGTCTTTT