Description :
From Genome Similarity Track
Location :
contig_28:189804- 192111
Transcript NameFunction/comments
g6931.t1RAW28048.1 hypothetical protein PC110_g15565 [Phytophthora cactorum

Sequence
2307 bases(100 bases per row)
GGAGTTCGGCACGAGATTGACCTCGTGTCTGACGCGAAGTACTGTGTGACGCGACAATGGCCACTTTCCCGAGACCAAGGCGAAGCGATCGATGCCTTCT
TCGAGGGTCGCCGACTAGCCGGCCACGTTCGTAAAAGTATCTCCCCGCATTCCAGCCCGACGTTCTGTGTGAAGAAGGCTACTGGCGGATCCTTCACACC
TTTAACAAGCTCAACGATGCCACCACCCCGGCGCAGACGCCAATTCCGCGAAAAGACATGGTGCTCGACACCACGTCTGGCAGCACCTCATACAGAACTA
TCGAGTTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGACGACGTGCCGTTGACAGCTGTCATCACGCCTAGTGGAATGCTGCGGGAATGGCTTGA
AATGCTGCATGGACTCAAGAACGCTCCGGCTACCTTCAACCGGATGGTCTCCAACCTGCTGCGGCCTTTCCGTGACTTTGCGCCTAGCTACTTCGATGCA
TCTTTATCCTCAGTCATGCCGCGCGGCATGACTGATGTGCACCTGGATCACCTCCGCCAAGTGTTCGAAGTGATGCGAGACAACAAGCTGTACCCCAACC
TGAAGAAGTGTATCTTTTGCGCTCCCGAAATCCCGGTGCTCGGGAGCTACGTCAGCAAGGAAGGTGTCCGTGCTGACCTGGAGAAGATCGAGGTCATTTG
TGCATGGCCTCCACCCCAACACCAGAAGCAGTTTCGCCAATGGCTCGATCTCGCGACGTATCTCCATTATTACTCGAAGAACTTCGCACTGATTGTTCGT
CCACTATCTCAACTGCTCAAGGCAGATGCCACGTGATCATGGCGACTCGAGCACCAGATGGCATTCGACGCGGTCAAGACAAGCCTCTCCACATCGCCCT
TCCTGATGTGACACGAAGCCTTTCCACGTGGTGTGTGATGCGAGCGACTTCGCCAGCGGCTGCGCCCTGATGCAGTTCAGCGACGAGGGACGCGAACAAG
GGGTGAGTTAGTTACCAGTTGCGTCAGTTGAAGCCAGTGGAGAGAAATTATCCCGTCCACGACAAGGAGCTGCTACTGTAGCAATGCGCTACACGCTCAT
CCAGTTCCGACTATACCTTCTCAGCGAACAGACATTCGCTATTTTCAGTGACCATGCGTTGCTGAGGACAGCGACGAAGAGTCCCCTCTCAGTCAACGCA
TAGCACGTTGGTTCTTGCTGTTCTACGAGTACGCTTCGTCGTGCACTACAAGCCGGGCCAGATGAACATACTCATTGACGCACTCTCGCGTTGACCTGAT
TACGCGCAATCAGGTCGCCACGCGGTTGGCGACGAGGATGACGATGAATGTGCCGTGTGTGTATCTGACGAGTTCGCTGCCGTCGAGGTCGCAGCGACTA
GTCCGCTCCCTGACGTGATTATATCCGCGTACGAGTCGGACGCGACATGCTCCGAGATGATCAAATACCTGTGAGCCCTGTCCGACGCGGCACGATGTCT
ACTGTCTCCGCGTAGCCGCGCACTTATCGATCGATACGCGCCGGATGGATCCCTGTTGACTTACTGCATCGACCGCGAGGATCCTCCGCGCATCGTCGTA
CAGTTGGGCGACGACCTTCGAGCTCGCCTAAGTCACGAGTTCCATGCGGCGGACACCTCAGTCGCGAGAAGACTTTTACTTCTGCTCTCTCGCGGCTTTG
ATTGAGCCCACATGCACAAGTGGGTCCGGAAGTGGGTGCGATCCTGTGAAGCGTGTGAACGCGTCAAGCCGGCTTCCTCGCGCCAAGCTCCGCTACATCC
ACTACCAATTCTGAGTGATGCTTGGCAATCGTTGAGCATGGACTTTGGTTTTGGCCTTCCTCGAGGCAGCCAAGGGCTTACGGGTCTCCTGGTCGTCGTT
GATCGGTTAAACAAGATGACCCGTCTTGCTCCAGTAGCTGTTACCGTCACGGTAGCCCAAACGGCAGCGATTTTCATTGACACGGTCTACCGCCATCATG
GCTTACCGACCACGACCGTGTCTGATCGAGATTCTTGCTTCACTGCAGTATTTTGGCCAACGCTCTTCAAGTCACTCGGGACGCAGTTAGACATGTCCAC
CGCGTCACATTCAGAGAAGGATGGTCAGACTGAGCGTATCAACAGGGTCATGGACGATGTGCTCCGAAGCTTCGCCACGACGTTCAAGTCATGTAGGACG
TTCTTCCCAATGGTGGAATTTTCAGTGAACAACGCTGTCAACGCTTCAACTGGTCTCACACTCTTCAACGTGAACTACCGTCAGCATCCTCGAGTTCCAG
CCCTCCT