Description :
From Genome Similarity Track
Location :
Scaffold_4:1897912- 1900597
Transcript NameFunction/comments
Phyin_T30-4PITG_03473Callose synthase%2C putative

Sequence
2685 bases(100 bases per row)
ATCACCACTCGATGCCGTCGATGTCGCTCACCCAGTTGCTCAGGACACGTGCGATTTTTCGCTGGATCCATTTCAGTCGTCAGACCAAAAGAGTGTAGCC
AAATGTTACACTTGATCGTCGTATTGAGATGAAAAGATCCGATAAAAAGAGGCGCAAAGTGAGACAAGCGCTGGCGTAATCGGACTATTTTGTCTTATTA
TTTTACAAGTTCCTGTAAATGGAGCTTGGCGCTAGGTCGCCGCTGTGTGACAGCTACATGTACAATTGATGCAAGCACCGCTTCATTACATGTGTGACAG
CGATAGCGTTGTTTGAGAAGACAAACGTCGCGACGTTAGGGGCTCAACCTTGCGCTCTGACGATCTTGCCTGTCCTCGCTCAACACACGTTTCATTAAGA
GCTTCTTCACAAGAAGAAAGATGAAAATGCATGTTCATTGCGTGTATTGTTTTGCTATTGAAATACTGGATAGGGCGTGCGAACAAAAAGCATCATGGAA
TGAAAAAGCAGACGTCAGCGCATTCACAGGAATGGTCCAAAGTTCCTAAAGACACTTGCCACCACTCCAAAACGATCCAACTTGGATGCGGGCAATACGA
TTTGCTTCGTCTAGTCACTTCGTTTCTTCTTCTTGGCCACACGCTTAACCTTGACGATCTTGCTCGTGGACGAGGCCGCCTCGTTCGCAAAGAGTTTCGA
CACCTCTAGTCCCGATGTGAACGCGTTGTTGAACATGACACGCTGCTGGAAGGCCGAGAGGAACGGCAAGAACATGGCAATGAAGAGCACCGGACCCAAA
ATGATCCAGCCCGTCCATCGGTCGTACGATCGGGCCATCGCGCGCACCACCACGTGACTCGTCTGGTTGCGGTAGACGCATAGCTGGAGGAACCAGTACG
CAGCGATCAAGATGATGATGATGATCTCCAGCAAATTGGTGAGCGAGATGACCAGCAGACTCGCGCATGCCACCAACAGGCCACAGCAAGAGAGCACAAA
CTTCATCTTGCGTAGCTTCTTCTGCTTAAAGGTCAATTTCTTCTTGACACGGCTGGCGATGTAGCCACAACACAGCAGTAGTAGCACCAAGATGAACATG
GCACCAGAGAGTGCGAAGGAGATCATGGATCCCTTCTCGATCTTCAGATCCCGGTCTTCGTAGTACGTCTTGTACGCCAACTGCAGATACAAACCGTAGG
CGACGAAGAAGAAGCGCGTCTTACGAATCATCGACACGAAACGAGCGCCCTTTGTCGAGTGCTCCAGGTACTCCACTTCATTGGACCACCAACCCGACCA
ACTGGCAGCAGAGTCATTCGTCGTCTTGAGCCAGTTCTGCCAATCATTGTAGTCCTCGATCAGCTTGTCCCAGTCAAAGCCACTCGGGTTGAAGAAGAAC
GGAGCCCACAGCCACGTCGCTGCAATAATCCACAGCGAGTACGACATAATGCCGTAGTTCTGGTTCGTCGGCTCGACACACGTCTGGTAGTAGTTAGCGT
AGCATCGAGTGTTCCAGTCATTATCTGACGGCTTGTAGTAGTTGTAGAACAAAGCATCCTGCGTCCACGAGCAGTTGCACCACGAGAAAGTGCCGTACAC
ACGGAACAAAATCAACAGGAAGATAAGCTCCACAGCACGATAGAAGTGGCTGAATGCGTAGAAGCGGTAAAGCTCGGCGAACTTCTCGTGCTTGATCGTG
AAGCCACGACCCGTAGCGCGGTACTTGGCACCACCGTGGATTAACGTGCGGTCGAAGTAGTGCATACGCGTGCCCATCTGGAACGTGAAGAACAGAGGAC
CAAGAGTCATAATGTTCCAAAGCAGATACGTCACACCATGACGGAAGCCCTGCTCGACACCCACGACGGCAACAACAGGCACTACAAGCAAGAAACCGAA
CTGGAAGGCCCACGATGTGTTCAACGTACCACCAATACCCAGACCACCCTTTTCGAGGAAGAAGCTGTCCATGCCACTCAGAGCCATGTACACCTTGCCG
TAGATGAAGAAGTATACACCCACAACAGTCATCGTCTGCGTGAAGTACCATCCCAAGTTACCGTAAAACCACGAGTGCAGACGGAAGAAGTCCAAACGAG
AAGCCATACGCATCGCATCACGAGAAATCACACACTCGCCGGCACCCGAAGACAGTTTGGCTTCGAACAGAGCCAGCTGCTGCATACCGACATCACGACC
CTTGCCCACCTGGATAAACTCCTCGTGCGAGACGCGACCACCGCGAAGGGTACTGTTGAAACCAGCGAAAATATCTTCCGAAAGGTTCACACCCTTGGAA
GCCTTGGCGGTACCACCGCAGCCCATGGCAAACAGCTTGTCGAAAATATCGGGGTGACCGTAGTGCTGGCGAACATGGTTTATCGCCAGCATACGCTGAC
CAAGCGATACGAACGACAGCTCCTGAATGGACATGAAACTGGCCAAATTGGACACGCCACCCGTGAACACGTGCTCGCGAAAACCAATAATTGTGAGGGG
GACCTTGGTAGTCTCGGTATCCTTCGTCGATAGAAGGTTCGGCATCTTCAGGGCCTCTTCAAGGTAACCATCTTGGTTCATATCGATACACTGGAGCAGC
TCACCACGCGAAAAGATAATGGCGTGGTTCTGGTTCTCGGGCTTACCTTCACCAATGATCGGGTTACCCGGCAGCTCGACACGGT