Description :
From Genome Similarity Track
Location :
Scaffold_46:189790- 196716
Transcript NameFunction/comments
Physo_136504reverse transcriptase
Physo_136505hypothetical protein

Sequence
6926 bases(100 bases per row)
AGCCGCGCCCCAGGAACCAGGGGAACACCGGGCACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACTCTAAGTCTCCATGAGGGGCGTGCGGGTGGCGCA
CGCCATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATC
ATCCCTTGAGAATCTTGATCGACTCTGGGGCGTCCACGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCAACAAGTACGCCGATGCGCTACGAGG
CAGCAAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTC
GACAGCACGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGTG
GCAAGGCCATCAGGGCCAGCCGTCCCCCACGCTCTGACAGAGCTTTGATGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCA
GGGCGCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGAGCCGGACGAGGCCTGAGAGTGGAGGTGCCGGACAGCGCC
TACCAGGTGGGTAACGTAGGTCCACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGTCGCTGGCGTTGGCGTGGGTAACCAAG
TTCCACGCGAGGTCACTCAGACCATAACTGATGAGGAAGGCACTGCAGGCGCTTCCGGTGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAAC
TGATGCGGGAGTCGCTAGAAGCGCTCCTGGTGTGGGTAACCAAGTTCTACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTT
CCGCTCAAGGACCAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCAC
GTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTT
CGACGGCGCGACCGGTAGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCTATGGAG
GACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACC
AGGCAGTCTTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGTTCTGAGATTCTTAAGAACCCCGGGGACCCGGTGTATCCCTTGGTAAAAGAGTT
CGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACG
AGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACT
CGACGCCTACCGTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGAT
CCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGC
GACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCT
TGGTCGCACAACTGTTCCGACCTTTGCGTGCGCTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGA
GGTGCATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAACTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAG
GTCCTGGGTTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGATCCGGAGAAGGTGAAAACCGTCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTAC
GACAGTGGTTGGGCCTCACCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACTGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTG
GCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGC
GTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCA
AGGCAGCCGAACGGAACTATCCAGCCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTT
TGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAAC
TTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGG
ATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCTCTGGCTCGGAAGCCAAGGCCGAGTGGCT
CACGCCCCGACAACGTGCAAGGCTGCTCCGCTATGAGTGGGCTGACGGTTTGCTCCACTATCGAGTCGATCCCGAGGATCCTCCCCGTATTGTCGTGCCC
AACGACGAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGA
TGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGAACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATT
GCAGAGCCTGCCGGTCCCAGTGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCC
TTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGACCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGAC
ACCACGGTCTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGAT
GTCGACGGCGGACCACTCGCAGACGGATGGCCAGACGGAGCTCGTCAATCGCGTGCTCGAAGACACGCTTCGCAGTATCTGCGCGGAGATGCCCCGCGCT
TGGGCTGATCGCTTGCCCATCGTTGAGTTCGCACTCAACAAAGCGGTACATGCATCGACGGGCTTTATGCCCTTTTACCTGAACGGGTTGCGCCACCCTC
AGGTGCCGCTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGC
CACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCTGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAG
TACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAATCTACCGCTAAACACTGTTAGCTCGG
TCGAGAGCAACAAGCTGAAGCGCCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGACCAAGTCGATGACGAC
TCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACTATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCA
GCTCCTCGAAGCGCGGCGTCGAGTCGAGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCC
GTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGG
TTTCGCAGCGAGTCGTTAGCCGACAGGTCGGCTCGACGATCCACACGGTCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCC
GCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACG
AATCTCCTCTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGC
CCTCCTTGATCGTAATTGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGGAGGGGTTACCCTGAGT
CGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTT
GGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCT
GCTTCGAGTGGAGCTTGCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTC
TTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCGGATCATGTTGTCATTCGGCTTGACCCAGTGG
AAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACC
GGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGC
CGAAAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCGTGCGGGTATGTGGTATCCCCGCCTGAAGAAGACTCGATGGCA
GTCGTGGCAGTCGGCTGCCTGGCATACGCACCCAAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGATCGTGGA
CGGCACCCTCCTCATCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGC
GGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTAGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAACCC
GCGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCG
CCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTGCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGAC
GTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGA
CTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTACGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGG
CCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGACGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACT
GTGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGC
GCCAGAGTTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTAGTCGATAAGATCGAATCTAAG
TGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTGTCACTAGTCCGGGATTGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCA
GAGCTTACAGATACATTTTGTATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGAT
CTACCGCTTTTCAAGTCAAGTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCC
CGTCACAGAGGCAGAGCACGCCGACA