Description :
From Genome Similarity Track
Location :
contig_19:189771- 191849
Transcript NameFunction/comments
g5143.t1XP_009537317.1 hypothetical protein PHYSODRAFT_528062 [Phytophthora sojae

Sequence
2078 bases(100 bases per row)
TGGACGAGTTGGAAGTCATGCGGCTGAGCTGTTCGCTCGGAATGCTGTCGTCGGTGAATCCCAAGGATTTCGAGATGGAAATGCTCGAAGCTCGAGAGTT
TGACGAAGACTTCGCCCTGTTCCTACGCAAAGAGGTCTTCGGGGCGGATGAAAAGGGCGAGTCTGAAGGCGTCAAAGCGCTCTCGTTGTTTGGCAAGCAA
GAGAGTGTGAAGAACGAGCTGGAGACGTCAAAGTGCTGGTCGGAAGAGATGGAGAACAACTTGAAGCCCGAGGATCAAGGCATTTACTGCGTTGTCCAGA
AAAATGCTGGCACGTCGGTGCGTACGCTGGTGCTGTTCGGGTGGCTCCAAGACGGTCTGTTCCGAAAGTCCCGCCTGCGTGATACTGCGACGTACGTGCT
GCGCTTCTTGACGTGTCTGAGCCCCGACATGGTGTGCTGCCTGTCACCCGAAGATGTTGAGCTACTGGAGCAAACTGTAGCGTCAATGAACTCGAACAAC
TTGGACGCCTGGAAGTCGTTTTCGGTCGCTTTCCACGTGGAGAGACAAGAGGAGGAGAAAGACGCGGTCGTGTGCGAAAAACTGGGGAGTGTCTTGTTGC
CATTGAAGTCCACCACGCAGAAGATTCAGCTGCTGAAGGGCAGCTATCCAGCCGTTTCCGTGGTGGAACCAGCTCCGGCGACGAAATGGACCGAGGCATG
TCACCACCGACTCGATACTGCGAAGGAGTTTGCGACTTGGCTCGCAGCTGAGTCGAAGCAGCGCAACCTGAAACTTGAGGTTGGTGCCAACCGTGATTAC
TTCTGCACTGAATTGCTGAAAGCTGTCGGTAGTTGGCCCGAAGGAGAGCTGAAGGCCGTCAAGGAACTGCTCGACCGAAGTCTCCAAACCTGCACCGAGC
AGTCGAAGGACCGCGCCCAGGCTTACATCGAAGAAACTCGCGAGGAGTTGCTCAGTCAGATGGACGAGTTATTCGACTTGGACGTGTTGATCAAGGCGAA
AAAGGGAGAGGAGCCCGCGTTCAAAAGTCTCAACGCGTACGTTCAAAACGTTCAATCGAGTCATGAAATCTGGAGCAAGCTCGACCCCGAGACGCAAGCC
GCGTTGAACATGCCCCTCCGTCTCAAGAACCAGATTAAGGCTATTGCCTCGGCATACCGAGGGCATCTAGCAATGAGCGGGGATGCAAGTGAAGAAAGAG
AAGCTCTTGCACTTTTCCTTGGCGAATTTGCGGTGTCGGACAAAAGAGTCTTTACCAGTGGCGATGGTCTTTGGGGGCGAACGTGGAAAAAGGTTGGTGA
ACTGTGGAGGGGTCAAGATTCTGAGCTTCTCACGGACGAGTTTCGCCAAAGCATGGCGGACCCATTGCTTGAGGCGCGTAAAACCTGGTACGAGGCTGTC
GAGACTGTCCTCACCGCAGCTGAGAGCGTCTTGATAGTGCAATTCAGCGAGGAGAACGAACGTTCACTACGCCAATCGTGCGAAGCTGATGAGCGCAAAC
TCATATCTGAAGCTTTCCGTGACCTACTCGGGTCTTGGCGAGAGAATCACGAAGGAGGTCTTTTAACAACTGTCCGTCCGCGTGTGCGTCTGCCTGCGCG
TTTAATTTACTGCGACGTCCAGAAGGAGCACTGGAAACCAGCTACAGACCAGATGAAGGTGTTCAAGCTTGCACAAACCGATGATGGGACATTCAGTACG
CAAGAGCTAGGGAGTCATCGGCTGGAACCGGACGCCAAAGTCTTGAAAGCGTTCGCCATAAAAACCCACTGCGTCATCTTGGTGACTACTTCCCCTCGGG
GAACGTTGACGGAGCGCATTGACTTCCCGCTGGAACGGTCTCGGTGGGGAGAAAGCATCGGGAAGGTTACGTTTACACGCCGTTTTGGTAAGCCCGCTTG
GTTGTGCGACTTCAACGTTCAAGAGCGTGTCGTAGCCTTTGTCGAGGAAGCAGGTCGAGTGATTCTCTATCGCTTCAACGAGACGTTTACGTCACTTGAG
ATTTTCAAGCGGCTTGAGTTGTCACTACGAACGTCGCTGGTACTTCCGGTCGCAGATGTGCTGCTCGTGGATGGATCC