Description :
From Genome Similarity Track
Location :
contig_28:189752- 191669
Transcript NameFunction/comments
g6618.t1hypothetical protein

Sequence
1917 bases(100 bases per row)
CTCGTTCATGAATTCATTGACATCTTCCCGGATAAAGTCCCCGCTGCTCTTCCCCCTAACCGTGGAGTTCGGCACGAGATTGACCTCGTGTCCGGCGCGA
AGTACTGTGTGACACGACAATGGCCACTTTCCCGAGACCAATGCGAAGCGATCGATGCCTTCTTCGTGGGTCGCCGACAAGCCGGCCGCGTTCGTAAAAG
TATCTCCCCGCATTCCAGCCCGACGTTCTGTGTGAAGAAGGCTACTGGCGGATCCTTCACACCTTTAACAAGCTCAACGATGCCACCACCCCGGCGCAGA
CGTCAATTCCGCGAAAAGACATGGTGCTCGACACCACGTCTAGCAGCACCTCATACAGAACTATCGAGTTGATGGATGGCTTCTACCAGATCTTGATGCG
CGAAGACGACGTGCCGTTGACAGCTGTCAGCACGCATAGTGGAATGCTGCGGGAATGGCTTGTAATGCTGCAGGGACTCAAGAACGCTCCGGCTACCTTC
AACCGGATGGTCTCCAACTTGCTGCGGTCTTTCCGTGACTTTGCGTCTAGCTACTTCGATGTATCTTTATCCTCAGTCATGCCGCGCGGCATGATTGATG
TGCACCTGGATCACCTCCGCCAAGTGTTCGAAGTGATGCGAGACAACAAGCTGTACCCCAACCTGAAGAAGTGTATCTTTTGCGCTCCCGAAATCCCGGT
GCTCGGGAGCTACGTCAGCAAGGAAGGTGTCCGTGCTGACCTGGAGAAGATCGAGGTCACTTGTGCATGGCCTCCACCCCAACACCAGAAGCAGTTTCGC
CAATGGCTCGATCTCGCGACGTATCTCCATTATTTCTCGAAGAACTTCGCACTGATTGTTCGTCCACTATCTCAACTGCTCAAGGCAGATGCCACGTGAT
CATGGCGACTCGAGCACCAGATGGCATTCGACGCGGTCAAGACAAGCCTCTCCACATCGCCCTTCCTGATGCTTTCTTATCACACGAAGCCTTTCCACGT
GGTGTGTGATGCGAGCGACTTCGCCATCGGCTGCGCCCTGATGCAGTTCAACGACGAGGGACGCGAACGAGGGGTGAGTTAGTTACCAGTTGCGTCAGTT
GAAGCCAGTGGAGAGAAATTATCCCGTCCACGACAAGGAGCTGCTACTGTAGCAATGCGCTACACGCTCATCCAGTTCCGAGTATACCTTCTCAGCGAAC
AGACATTCGCTATTTTCAGTGACCATGCGTTGCTGAGGACAGCGATGAAGAGTCCCCTCTAAGTCAACACATAGCACGTTGGTTCTTGCTGTTCTACGAG
TACGCTTCGTCGTGCACTACAAGCCGGGCCAGATGAACATACTCATTGACGCACTCTCGCGTTGACCTGATTACGCGCAATCAGGTCGCCACGCGGTTGG
CGACGAGGATGACGATGAATGTGCCGTGTGTGTATCTGACGAGTTCGCTGCCGTCGAGGTCGCAGCGACTAGTCCGCTCCCTGACGTGATTATATCCGCG
TACGAGTCGGACGCGACATGCTCCGAGATGATCAAATACCTGTGAGCCCTGTCCGACGCGGCACGATGTCTACTGTCTCCGCGTAGCCGCGCACTTATCG
ATCGATACGCGCCGGATGGATCCCTGTTGACTTACTGCATCGACCGCGAGGATCCTCCGCGCATCGTCGTACAGTTGGGCGACGACCTTCGAGCTCGCCT
AAGTCACGAGTTCCATGCGGCGGACACCTCAGTCGCGAGAAGACTTTTACTTCTGCTCTCTCGCGGCTTTGATTGAGCCCACATGCACAAGTGGGTCCGG
AAGTGGGTGCGATCCTGTGAAGCGTGTGAACGCGTCAAGCCGGCTTCCTCGCGCCAAGCTCCGCTACATCCACTACCAATTCTGAGTGATGCTTGGCAAT
CGTTGAGCATGGACTTT