Description :
From Genome Similarity Track
Location :
Scaffold_65:189724- 191497
Transcript NameFunction/comments
Phyca_LT1534205103'5'-cyclic nucleotide phosphodiesterase, putative

Sequence
1773 bases(100 bases per row)
tcatggagttgggtaaggatattatggagtgtgatcgctttggatttctacttatcgaccatttcaaacatgaactttggattactccacgcgttggtgg
tgagagtatccgctcgcccatcaaccgcgggatttcagggctagtagctactactggcgagactgtgtgtactcgagatgcctacaagcatgagctcttc
gacccaagtgtggatatgaagacggggtatcgaactacaagtgttctttgcatgccggtattcgaagatcactcaatcacgatccctcctaaggtagttg
ctgttgcgatgtgcatcaacaagaaggaaggagctcacgttgtcgccttcactaaaacggaccgtgaaatcatgaccaagtactgtgctgaagtgcagtt
tgcgctcgggcgactatcccttgatatctcgtactacaaggtcgtgtcggactgcgttgcagtgtcacgtacaggcgtagactcgagtgcgagagtgctg
aagcggatgtcaaccacaaaccgcattgacaaattctccgagaccgacatcatttcgtccattgtacacaagtactgccactccggcgacgagcaggcta
gtgaaagccagaaaaaagcggtaccctcctttgcagcgttgctgccagtcatcaagaagaagagtcacgaagatgatgaagtgccattcccacgcgaaat
cctcttcacacatggacgagatgaaccgctggaccattgggataccgaaacaatctcgctttcgagcagtgaggtgtctatgagctgtggggttatcttt
cgtgcatatgggtttatggatgctttccgggtttccagtgagaagttatcggcttttacaacgaatgtggcgaattactatcgtagcaactctttccaca
actttcaacacgggtttcaagtgatggttgctatgcatatcatgctacgtaccgagtgccgccggtacttcagcggtctcgagatttttgctatgctgat
tgcctctttgtgtcacgatatcgaccatccaggaaataccaatgacttcgagctgaagatgctgagtcctatggctctcacgcacaacgatgatgctgtg
ttagaacgtcatcactgccgagtgactttcatcattctcaaccacaagtccgcgaagatcttgcagcatctcgaccgggagcgccagaaacgagtgcgac
aattaatcatttcgtgtattctcgcgacggacatgtcgaaacactttgagaagtgcaaagtcctcgaaggtcttacacgtcgacagcttggagataaacg
cccaatcttcatggggcctgatgcacgcagccgatatatcgcactatgcgctgccgtttcctcaggctcaagagtggggagctcgcttgctcgatgaatt
ccagaaccaagccgctgctgaagccgaacatggtgttcccaccgactatttcatgcagaacctggagaacaagcgcgttcggatcactgtgcatctgagc
ttcatcaactacgtcgtgcgtccaatttggctgccattgacttcgctttgtcatcaccttcgggtacgctgcgtgttctgctgtcagaatttgcatacag
gctatatactaactgctttggtgctgtagttttacacagattcgctcgagaaaaactacgagacgtaccgacaacaactgagcaagaatacgagtaatgt
agctccaaacccctcggcagctacgacaccattgccccctcaatctgctagcagaaacatattgccttcctct