Description :
From Genome Similarity Track
Location :
Scaffold_610:1897- 4201
Transcript NameFunction/comments
g15047.t1hypothetical protein

Sequence
2304 bases(100 bases per row)
ATCTTGAGTGCGCGCATGATCGTTTGAACCATGCGCGCCGCCGTATCGTTCTCTTGCGGTCAGTAAGCTATAGTGGCCCTCTGACGCTGTCCTAGGATCT
TGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGCTCCCGATCGTGCCGAATTACCTCGCTAGCGCCAAATCGGCGGAATACACATTCTTCGTAGGA
TTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGATCAGCAACTCCGTGTTGCCTCTATAC
GATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTTGCTTGGATATTCCCTGGCGACTCGCCTCGGATAGTGGGCCGACCTT
TCCGGTCTCGCAGTCTACACATTCCCCAACGTACCGTTGGACACTCCGGTACAGGCCTCTCCAGTAGAAATGATCTCGGATCCGCTGGTAAGTGCGGCCG
ATCCCTTGGTGGCCTCTCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCGACCAACCGCATCGTGAGATCTCGATCTT
CGTCAGACTTCCGGTTTGGTGGACAGTAGAAGCGTAATCCGTCCATCTCGTAATCCATTGCCAGATTGCTGTAGGATCGATCTTCTTCCTGGGTTCAAGT
AGCTACATCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCGTCTTGGGCCCAGCGAATTCACCCTATCCTGAGCTCCCTCACCAATTCT
TTCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGGTCACCGGCGAGATCTGGACCACGGATTCCTCGGAGTGCACGGTCAGAATCT
CGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCCAATTGCCGCTGAAGGGCAGCTCCGGCGAGGCTGTCAGCGGA
ACCGTTCCAATCTCGCTTAACATGTAGCAGCTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAACAGAACCACACCTGGGGCCTTA
CAATGAATTTCCCCTCTCACTTGCCGGATCACCAGGTTCGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAGCCAGGAGGTCGAAACACAACA
AGAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACGGTCCACTCTGGTAGTTTCCACAGGATCGCGCT
ATACGCGCCTCCTCCTCGTTTACTCGGGCCGATCCGTCGAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTGGGTACGGGAGCTTGGATCTACC
GTCGGGGTTCTTTCTTAGGCGCGATCGCGATCAACGCCTCCTCCACATCGGATCTAGGTGTAATACTGGCAGCCATCTCCCCTAGGATTTCGTCTTCGCC
TTTGGTACACTTCATATTTTCAAGTGTCCATGGCGACAGAAGGACTGCCCATTGACCCAGACGTCCGTGTAGCCCCGGCGATCGGAACAACCATGCTAAC
GTCGAATGTCGAGTTAGGGTCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGAACCAAGATCCGTAGCAACGCCAGCACTTCCTTCTCGACCACAT
TATAATTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACTGGGTAGTAGATCTGATTGTGACTCTGCATCAAGGCGGCGGAAATAGCCCATTC
GCTAGCGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGATCTTGTCCTTCAACGCTGCAAACGACCTATAT
GCTCTGACCCATCTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGGTCGGGTTCAGACGAACTGTGAT
CCAGGATCCGACGAAGATCTGGGCACTTCTTCAACTCAGCGAATTCCACTTCGTGCAATTCATATTGAACGGCAGCATAGATCGCATAGTCCTCAATAAA
TCGGCTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGCGATCCCGGAAAAGGTAGATCCGTCAAAGTCTTCAAGTCCTTCGGATTAGCT
TCAATGCCATCGTCGGACACTCGGTGTCCCAAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAGACAGGTTCCATTTATCACACG
CTCC