Description :
From Genome Similarity Track
Location :
Scaffold_1720:1897- 3312
Sequence
1415 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACGCTGATAGAGAAATTCCACTTAGTACACGCC
TCCAGTAGGGATGTCACCCTCTCGCACAACTGATCCCACGATTCTGCGGGGATTAGAATATCGTCGATACAAGATCTGCGTCCTAAGACAGACGGGGTCC
CAGGATCCCCTGGCTCTCCTGCTTCGAATGGATCCACTTCTGTAGGCTCTTCCCCGGATCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAG
GGTGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGAT
ATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGGCCATGTCAAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCAT
TGATTAGAGGCATCGGATACACCATCAGTCTGGTCAGACCGTTAACCATCCGGTAATCAATGCACAGGCGTATATCTACACCGTTCGTCTTGATGATGAT
TACCACCGGAGATGCCCACGGGGACGTTGAGAAGCTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAGCTGAGGTGCC
ACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATATTGCCTTCCCCGGA
TCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATC
CGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCAATGTCTAGAG
AACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTGATTAGAGGTATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGTCGGTAATC
AATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAGCTGATGATCTTGGCTTGCAGCAGG
CCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGA
CTCCGCGGGCAGCGGGCGGTAACGCATATTGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCCGGTGAACCCATAGAGGGCGTTATCGATCAGG
CGTTGGTAGATCTGG