Description :
From Genome Similarity Track
Location :
scaffold_209:18966- 21988
Transcript NameFunction/comments
Pl_107670hypothetical protein PHYSODRAFT_474806
Pl_107671hypothetical protein PHYSODRAFT_284181

Sequence
3022 bases(100 bases per row)
TTGGATTCAACGCGGTGCTGTGCTTCTCGTTGCTGATTATTCCTGCCACACGTAACTCATTTTGGATGATCTCCATGGGCATCGACTACTCGCACGCTAT
CAAGTATCACCGCTGGATTGGATTCTTCACAGTTGCGATGGTGGCGCTCCACGCTATCCCTTACTACTACGCGTGGTTCAAAGCGGGCACGTTTATTGAG
TCGTCATTTCCCTGTTTGGACTGTGATTATGGAACGGTCGGCAAGTCACGTTTGCAGAACTTCTGTGGGCAACTGGCACTGCTCTGCTGCATCGTCATCG
GAGTGACGTCGCTCAGCCCGATTCGCCGCAAGTACTACGACATGTTCTACTACTGCCACCACCTTTTCATCCTTGTGCTCTTCTTTAGTGCACTGCACTT
CTCGCAGTTTGTCATTTGGATGTATCCAGCTGTCTGCCTCTATGTCATGCACCGCATCTTGGCTCGAAGTCAAAGTCGTATGCCGTGCGAAGTTGTGGAT
TTAGAAGCCATTCCCGGTGAGATCACGCGTCTGGTGTTCCGCCGATCACCTGGCAAGTCGGGCCACTACCATGCTGGCCAGTTCGTGTACCTGCGTATTC
CACTGTTGTCCCACACGCAATGGCACCCATTCAGTATCAGTTCATCGCCGATCGAGTATGAGGACACATTCACCGTGCACGTTAAGTGTATTGGTAATTG
GACCAAGTCGTTGTATGCGGTAGCTATTCAGGCGCGAGAGGAACGCAAGATGCCACTTATCTACGTCGATGGATTCTACGGCAAGATGTCCGACGATTTC
CAGCACTACCCAGCTCTAGTGTTCGTGGCTGGTGGTATTGGTGCAACCCCGATTATTAGCATTGTGGGTAAGATCCTCGACTGCATGCGCAACAACGACC
CAAATATGGAGTTCACGCAGGTGTACTTCCACTGGACATCGCGTGAGATTGGTATTTTCCACGAGTTTGAGCCTCTACTGGATGCTATTGAGCAGTACGA
CCCGGACCACGTAAAGTTCAAAGTTCGTCTTTGCTTCACGGGTGACCAGCACTTAGGTGGTGTGGATATTCCCAACGGTATCACACTCAAACCTATGGAC
GATACGAGCATGGTTCCGACGCGTCCGTTCTTCCAGTCGTCCCGATCGGTGCCTCGTCAAATGGTGCTGTTCTTCGTGACGTTCACGTGCAGTTTCTGGT
GTTTGTTCCTCATCCGGTATGACTACCCGATCCTGGGCCACCTGCGTATCAATCAGAACATGTGGCCGATGCAGCGTGTTGTGGAGGTTCTCATCATGAT
TGTTGGTGCTGCTGTTGGCTGGGCAGTGGTGTTCACTGAGCCTACGCCTCGGTCAATGAGCCGGATGGAGAAATCGCGCCTTATGCCAACGCTAGGTAGC
TACGGCCCTCAGGAGACAATGGCAAATGTGGACCGTGGCACGGATTACTCGCATTCGCTGTCGTTCGATGGCCAGGAGGTTCAGTTCCATCACCCTGTTA
GCCGCTCACGGTTGAATGTGAAGGAGTTGTTCAACGAGGTTGTGAAGGAGCAGTCACACAACTTCGCTGTGAACATCACAGGTATCGGCACCTGGGTATC
AGGCCCCATGGGTCTTATTCACGCCGTGGAAACAGAGGCCTCTAACTTCGCAGGCATCTTCGATGTGCACTATGAGGAGTTTGAAATGTAGAACTACCCA
ACTACTTGGCCCAGTGCGTATGTGTTGTCGCGCCCACCCGTGCGTTTGCTTTCGTCGTTAATACCAATAAGTAAGGTGCTTCTCGGAATGTGTGGAGTGC
TCTGTTGCCTTCATACGTTGTTAATGCAATGTTCTCCTTAGCCAATGTGCCAAGTACTACTGTAATGGTTTGACAAGCATTTGTCAACATCAGCGCAACG
TGCATCATTGTGTTAGATGCTGAATGAGACTAAGTGCTCATGTTGCCACCAAGATGGAATGAACCAAGTCCAAATGTTGTAAAGCAGAAGTAACACAGGA
GACCTGCATCTCGAAAGCATGAACGCAGAAGAAACTCAATAGAAGACAAGAAGAAAAGCAACAGCGTACGGTGTGTGTTGTCACAATCCCTCTTCGTTGT
CATTGGGCTACCAAAGCTTGCTTGAGGACGTCGTACGAGCTATTCAACTCTCACGAACGCACTTAAACGCGGCTGGGGTACAGCATGACGCGCACGCTCT
TGCTGATGGCCTCGGCCGGCAGGTTCTTGGCGAACTTGGCGCGCACGACGCCGTTGCTGCCGTGTGCACGCATGACCTTGCCCCACACGACGCGGAACTG
GGAGCCGTTCTTCAGGGACTTGGCCTTGTAGATGTAGGCGATCTTCTTGCCCAGGTAGAAGTCCACGTCCTTCTTGTCCGTCAGGCCCTGGATCTTCACC
AGCGCAGTGTGCGAGTACTGGTTGCGCAGGCCGCGCTTGTAGCCAAGGAACACACCCTTGACGTAGAGACGAGTAGGCTGACCAGAGGAAGCGACCATTG
TAACGAAGTTCTGCACGATAACCAATAAAACCCAAGTCAGTTCACTCTGCAACGGTCTGCTACGTAATAAAACCCAATGGCGTCCGTCGTCCAGTGCCTG
TATGCTCTCGATATCCCCCAATTGCCTAAGAGAGATGTGTCTAGAGATTCCGTTGTCTTCTGCCTGTGTCTAGAGCTGGTGCTGAGCTGCGTAGCGTGGG
GTAGAGAGTCTCTCTCTCTCTCTTCTGTAGGCTGCATGGGGGATCGGAGGCTCTGACTGCAGACCGGCGCCATGGACTCGAGCTTCGAACGTACCAGTCG
GATGAATTGAACGAGCGAGGGACTGAAGGTGTGGCGGTGTCACGGGCGCTCAGCGCTTTGGCTGGGGCCAATCGATTGGCGGCCAACGCCCAGACGCGAA
GACCTTCCAAAACGTATATTACCTGTGTAAAGCGATAGCGTTAGATTAGAAATGTATCGAAGGTATGAACTAGGATAGGGGAAGGGGATGTAGTTTTGCA
GGGACATACAAAAAGCAAGATA