Description :
From Genome Similarity Track
Location :
Scaffold_77:18965- 20095
Transcript NameFunction/comments
Phyag_g1660hypothetical protein

Sequence
1130 bases(100 bases per row)
GTCTAACGCCATCTCAGGTTGAGGTGCGAAGCCCCCTTCGCCAACACTTTTGCCAAACAACAGCCGGAATTTTTGTGTGGGATGCACACCCCACAAGACA
ACATTCGAATTGATACCATCTCGAGCAGTTCTCAGAGCTGGCAACGTGATCTCGGTGAAAAAGTCAACGGCGTGCGAAGACGAACTTGACGAAAACACCG
AATTGAACTCCCAATCGGCCGAAGGACCCGCACCAGATAAAATCGCTCCTGCAGGTGCTCCACCACCTGAAGAAACCCCCGAGGGTGAATCAATAGTAGA
CTTGTTCGTGACTCGCACGCAATTCTGTAGCGGAACTACCTCGAACACTGGTGTTGCGCGATTTGCAGCAGTGACATAGCATGAGACGTGGATCTGGCTG
AGCACAGGAGCATCATTTGAGTTTTCTTCAACAGAGCATCCGCTCCTCTTGGCATCGCCGCTGTAGTTTCTTGTGCTGCCACCTCGCTCCGACATCACCA
CGAAAGAAGACGTCCGTTCACTGACACATTTAAATAAGATAAAAACGCCCAAACATAACAACTTCTACAACGCAACACCTCGTAAACCAACAACGAATTC
ATAAAATAAAAATCAAACGCACCGCTGCAATCCGCTGGATGCCGAATGCCGCGAGCTGCGCTCCAATAATGACTTTCCTGCTCCCTCGAGTTCGCTTCtc
ctgtcgctgctgcccatATGCTACCTACCGATACACCAGAGGCCCCCTTCGGTCTCTGGTCACTCTAGATTACATTATACTTTCTTGATGTGTGTTGCAA
CCGCAGCCACCATGGCGCGGAAGGTGATGGTGTCTTGGCGTGAAAACAAAATGCTGAACTCCGATTTTTGAGTAGCCTCGACAGATATGATTcacggctg
cagctcgcacgcggcaagctgcttcgtcgcgTCCTCGAATGTCGGGGCTTCGAAGGCTGGTCGCAAGAGAGAAAGCGCACGGGAGCCGCCATCCATGAAT
GCCATCTCAGCGGGTTCCTCGTTGATTTCCTCCATGATACTGTCCTCCAGGATTTCCGATCGCTCAAGCGGCATGTGCATGTCTGTCTTGCGGCCAACGG
TTTCAACAAGTTCGTCAAATAGCCCGATCT